1. A vertical cavity surface emitting laser comprising:
a lower distributed Bragg reflector;
an active region positioned on the lower distributed Bragg reflector;
an upper distributed Bragg reflector positioned on the active region;
a cylindrical volume removed from the upper distributed Bragg reflector defining a mesa with a substantially vertical side wall concentrically surrounded by the cylindrical volume, an isolation trench formed in a lower surface of the cylindrical volume concentric with the mesa;
an implant region including a portion of the side wall of the mesa and a portion of the upper distributed Bragg reflector below the lower surface of the cylindrical volume;
a planarizing material filling the cylindrical volume; and
n and p electrical contacts coupled to opposite sides of the active region for supplying operating current thereto;
wherein the lower surface of the cylindrical volume is formed so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases.
2. A vertical cavity surface emitting laser as claimed in claim 1 wherein the lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa.
3. A vertical cavity surface emitting laser as claimed in claim 1, wherein the implant region in the lower surface of the cylindrical volume extends at least into the active region adjacent the isolation trench.
4. A vertical cavity surface emitting laser as claimed in claim 1 wherein the planarizing material filling the cylindrical volume includes a low-k dielectric material.
5. A vertical cavity surface emitting laser as claimed in claim 1 wherein the implant region includes as least some of the cylindrical volume surface.
6. A vertical cavity surface emitting laser as claimed in claim 1 wherein the implant region includes proton implants.
7. A vertical cavity surface emitting laser as claimed in claim 1, wherein implant region in the lower surface of the cylindrical volume extends into the lower distributed Bragg reflector.
8. A vertical cavity surface emitting laser comprising:
a lower distributed Bragg reflector including a plurality of pairs of mirror elements;
an active region positioned on the lower distributed Bragg reflector;
an upper distributed Bragg reflector including a plurality of pairs of mirror elements positioned on the active region;
a cylindrical volume removed from the upper distributed Bragg reflector defining a mesa with a substantially vertical side wall concentrically surrounded by the cylindrical volume, an isolation trench formed in a lower surface of the cylindrical volume concentric with the mesa, the lower surface of the cylindrical volume, being formed so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases whereby the lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa;
an implant region adjacent a surface of the cylindrical volume including the side wall of the mesa and the upper distributed Bragg reflector defining the lower surface of the cylindrical volume;
a planarizing material filling the cylindrical volume; and
n and p electrical contacts coupled to opposite sides of the active region for supplying operating current thereto.
9. A method of fabricating a high frequency vertical cavity surface emitting laser comprising the steps of:
a) providing a lower distributed Bragg reflector on a substrate, an active region on the lower distributed Bragg reflector, and an upper distributed Bragg reflector on the active region;
b) etching a cylindrical volume from the upper distributed Bragg reflector to define a mesa with a substantially vertical side wall, the cylindrical volume extending into the upper distributed Bragg reflector to a lower surface adjacent the active region;
c) etching an isolation trench in the lower surface of the cylindrical volume concentric with the mesa and extending through the active region;
d) implanting a portion of the side wall of the mesa and the lower surface of the cylindrical volume; and
e) planarizing the upper distributed Bragg reflector and coupling n and p electrical contacts to opposite sides of the active region for supplying operating current thereto;
wherein step b) includes etching the cylindrical volume so that the lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa, and etching the cylindrical volume so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases.
10. The method of claim 9, wherein step d) includes proton implanting the side wall of the mesa and the lower surface of the cylindrical volume.
11. The method of claim 10, wherein step d) includes implanting the lower surface of the cylindrical volume so that the implant extends at least into the active region adjacent the isolation trench.
12. The method of claim 10, wherein step d) includes implanting the lower surface of the cylindrical volume so that the implant extends into the lower distributed Bragg reflector adjacent the isolation trench.
13. The method of claim 9, wherein step a) includes epitaxially growing the lower distributed Bragg reflector on the substrate, epitaxially growing the active region on the lower distributed Bragg reflector, and epitaxially growing the upper distributed Bragg reflector on the active region.
14. The method of claim 9, wherein step e) includes filling the cylindrical volume with one of benzocyclobutene (BCB) dielectric and a polyimide material.
15. A method of fabricating a high frequency vertical cavity surface emitting laser comprising the steps of:
epitaxially growing a lower distributed Bragg reflector on a substrate, epitaxially growing an active region on the lower distributed Bragg reflector, and epitaxially growing an upper distributed Bragg reflector on the active region;
etching a cylindrical volume from the upper distributed Bragg reflector to define a mesa with substantially vertical side wall, the upper distributed Bragg reflector being etched so that a lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa, and further etching the cylindrical volume so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases;
etching an isolation trench in the lower surface of the cylindrical volume concentric with the mesa and extending through the active region;
proton implanting a portion of the side wall of the mesa and the lower surface of the cylindrical volume; and
planarizing the upper distributed Bragg reflector and coupling n and p electrical contacts to opposite sides of the active region for supplying operating current thereto.
16. The method of claim 15 wherein the step of proton implanting the lower surface of the cylindrical volume includes implanting the lower surface of the cylindrical volume so that the implant extends at least into the active region adjacent the isolation trench.
17. The method of claim 15 wherein the step of planarizing includes filling the cylindrical volume with one of BCB dielectric and a polyamide.
18. A vertical cavity surface emitting laser comprising:
a lower distributed Bragg reflector including a plurality of pairs of mirror elements;
an active region positioned on the lower distributed Bragg reflector;
an upper distributed Bragg reflector including a plurality of pairs of mirror elements positioned on the active region;
a cylindrical volume removed from the upper distributed Bragg reflector defining a mesa with a substantially vertical side wall concentrically surrounded by the cylindrical volume, the lower surface of the cylindrical volume being formed so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases whereby the lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa;
an implant region adjacent a surface of the cylindrical volume including the side wall of the mesa and the upper distributed Bragg reflector defining the lower surface of the cylindrical volume;
a planarizing material filling the cylindrical volume; and
n and p electrical contacts coupled to opposite sides of the active region for supplying operating current thereto.
19. A vertical cavity surface emitting laser as claimed in claim 18, wherein the implant region in the lower surface of the cylindrical volume extends at least into the active region.
20. A vertical cavity surface emitting laser as claimed in claim 18, wherein implant region in the lower surface of the cylindrical volume extends into the lower distributed Bragg reflector.
The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.
1. A process for assaying a product sample in which material may be present that emanates from a particular type of animal selected from the group consisting of porcine species, and a ruminant as source, in order to determine, qualitatively or quantitatively, whether or the extent to which material from the particular type of animal is present in the product sample, said process comprising the following steps:
(1) providing a product sample to be assayed;
(2) extracting or isolating a DNA sample from the product sample;
(3) carrying out a polymerase chain reaction (PCR) on said DNA sample with a primer pair to produce an amplified DNA product representative of a predetermined short interspersed element (SINE) selected from the group consisting of PRE-1 SINE of the porcine species, and a Bovine SINE family of the ruminant, said predetermined SINE when present in the DNA sample being a marker specific for the particular type of animal, said predetermined SINE selected from a genomic subset common to members of the particular type of animal and not found in genomes of other types of animal,
the primer pair for the PRE-1 SINE of the porcine species comprising at least one of the primer pair (i) and the primer pair (ii), the primer pair (i) comprising:
a forward primer containing the sequence:
5\u2032\u2003GACTAGGAACCATGAGGTTGCG 3\u2032;
(SEQ ID NO: 3)
and
a reverse primer containing the sequence:
5\u2032\u2003AGCCTACACCACAGCCACAG 3\u2032;
(SEQ ID NO: 4)
the primer pair (ii) comprising:
a forward primer containing the sequence:
5\u2032\u2003GGCCTTGCTCAGTGGGTTAA 3\u2032;
(SEQ ID NO: 10)
and
a reverse primer containing the sequence:
5\u2032\u2003GGGATCCAAGCCACATCTGT 3\u2032
(SEQ ID NO: 11)
the primer pair for the Bovine SINE family of the ruminant comprising:
a forward primer containing the sequence:
5\u2032\u2003CAGTCGTGTCCGACTCTTTGT 3\u2032;
(SEQ ID NO: 7)
and
a reverse primer containing the sequence:
5\u2032\u2003AATGGCAACACGCTTCAGTATT 3\u2032;
(SEQ ID NO: 8)
and
(4) determining whether, or the extent to which, the predetermined amplicon is present in the amplified DNA product.
2. (canceled)
3. The process of claim 1, wherein the determination of presence of the predetermined amplicon in the amplified DNA product comprises:
performing electrophoresis for a predetermined duration of time at a predetermined voltage gradient, on a gel containing said DNA sample stained with ethidium bromide; and
examining the gel under UV light for fluorescence after the predetermined duration of time.
4. The process of claim 1, wherein the determination of presence of the predetermined amplicon in the amplified DNA product comprises:
adding SYBR Green dye in the PCR amplification step to provide a fluorescent signal; and
then evaluating the fluorescent signal for a PCR cycle at which it crosses a baseline.
5. The process of claim 1, wherein the determination of presence of the predetermined amplicon in the amplified DNA product comprises:
adding a fluorogenic probe in the PCR amplification step; and
then evaluating a fluorescent signal for a PCR cycle at which it crosses a baseline.
6. The process of claim 1, wherein the particular type of animal is a member of the order Artiodactyla and the predetermined amplicon is no longer than 140 bp.
7. The process of claim 6, wherein the member of the order Artiodactyla is a member of the family Suidae, and the predetermined amplicon is representative of porcine PRE-1 SINE.
8. The process of claim 7, wherein the polymerase chain reaction uses the primers comprising:
the forward primer containing the sequence:
5\u2032\u2003GACTAGGAACCATGAGGTTGCG 3\u2032,;
(SEQ ID NO: 3)
and
the reverse primer containing the sequence:
5\u2032\u2003AGCCTACACCACAGCCACAG 3\u2032.
(SEQ ID NO: 4)
9. The process of claim 7, wherein the determination of presence of the predetermined amplicon comprises SYBR Green-based detection and wherein an assay is provided having a minimum effective quantitation level better than 0.1 pg (0.0005% in 20 ng).
10. The process of claim 7, wherein the determination of presence of the predetermined amplicon comprises using a probe containing the sequence:
5\u2032\u2003TTTGATCCCTGGCCTTGCTCAGTGG 3\u2032.
(SEQ ID NO: 9)
11. The process of claim 6, wherein the polymerase chain reaction uses primers comprising:
a forward primer containing the sequence:
5\u2032\u2003GGCCTTGCTCAGTGGGTTAA 3\u2032;
(SEQ ID NO: 10)
and
a reverse primer containing the sequence:
5\u2032\u2003GGGATCCAAGCCACATCTGT 3\u2032.
(SEQ ID NO: 11)
12. The process of claim 6, wherein:
the member of the order Artiodactyla is a member of the suborder Ruminantia; and
the predetermined amplicon is no longer than 110 bp.
13. The process of claim 12, wherein the SINE is intra-Bov-tA2 SINE.
14. The process of claim 12, wherein the polymerase chain reaction uses the primers comprising:
the forward primer containing the sequence:
5\u2032\u2003CAGTCGTGTCCGACTCTTTGT 3\u2032;
(SEQ ID NO: 7)
and
the reverse primer containing the sequence:
5\u2032\u2003AATGGCAACACGCTTCAGTATT 3\u2032.
(SEQ ID NO: 8)
15-19. (canceled)
20. A process for assaying a meat sample of unknown content to determine the presence of pork in the sample, said process comprising the steps of:
(1) extracting a DNA sample from the meat sample to be assayed;
(2) adding to the DNA sample a primer pair
selected from the group consisting of (i) a forward primer containing the sequence of 5\u2032 GACTAGGAACCATGAGGTTGCG 3\u2032 (SEQ ID NO: 3) and a reverse primer containing the sequence of 5\u2032 AGCCTACACCACAGCCACAG 3\u2032 (SEQ ID NO: 4) and (ii) a forward primer containing the sequence of 5\u2032 GGCCTTGCTCAGTGGGTTAA 3\u2032 (SEQ ID NO: 10) and a reverse primer containing the sequence of 5\u2032 GGGATCCAAGCCACATCTGT 3\u2032 (SEQ ID NO:11),
whereby a pre-PCR mixture is provided;
(3) carrying out a polymerase chain reaction (PCR) on the pre-PCR mixture, whereby an amplified DNA product results;
(4) determining presence in the amplified DNA product of an amplicon representative of porcine PRE-1 SINE.
21. The process of claim 20, wherein the determination of presence of the predetermined amplicon comprises:
performing electrophoresis for a predetermined duration of time at a predetermined voltage gradient, on a gel containing said DNA sample stained with ethidium bromide; and
examining the gel under UV light for fluorescence after the predetermined duration of time.
22. The process of claim 20, wherein the determination of presence of the predetermined amplicon comprises SYBR Green-based detection.
23. The process of claim 20, wherein the primer pair is the SEQ ID NO: 3 and the SEQ ID NO: 4, and the determination of presence of the predetermined amplicon comprises:
adding a fluorogenic probe, said probe comprising the sequence of 5\u2032 TTTGATCCCTGGCCTTGCTCAGTGG 3\u2032 (SEQ ID NO: 9), in the PCR amplification step; and
then evaluating a fluorescent signal for a PCR cycle at which it crosses a baseline.
24. A process for assaying a sample of unknown content to determine the presence of ruminant-source material in the sample, said process comprising the steps of:
(1) extracting a DNA sample from the sample to be assayed;
(2) adding to the DNA sample a primer pair wherein the forward primer contains the sequence:
5\u2032CAGTCGTGTCCGACTCTTTGT3\u2032,
(SEQ ID NO: 7)
and the reverse primer contains the sequence:
5\u2032AATGGCAACACGCTTCAGTATT3\u2032,
(SEQ ID NO: 8)
whereby a pre-PCR mixture is provided;
(3) carrying out a polymerase chain reaction (PCR) on the pre-PCR mixture, whereby an amplified DNA product results;
(4) determining presence in the amplified DNA product of a predetermined amplicon representative of Bov-tA2 SINE.
25. The process of claim 24, wherein the determination of presence of the predetermined amplicon comprises:
performing electrophoresis for a predetermined duration of time at a predetermined voltage gradient, on a gel containing ethidium bromide; and
examining the gel under UV light for fluorescence after the predetermined duration of time.
26. The process of claim 24, wherein the determination of presence of the predetermined amplicon comprises:
adding SYBR Green dye in the PCR amplification step to provide a fluorescent signal; and
then evaluating the fluorescent signal for a PCR cycle at which it crosses a baseline.
27-38. (canceled)
39. The process of claim 10, wherein said probe is a TaqMan probe having the sequence of 5\u2032 FAM-TTTGATCCCTGGCCTTGCTCAGTGG-TAMRA 3\u2032 (5\u2032 FAM-SEQ ID NO: 9 -TAMRA 3\u2032).
40. The process of claim 11, wherein the determination of presence of the predetermined amplicon comprises using a probe containing the sequence:
5\u2032\u2003ACAGCTCACGGCAACGCCGG 3\u2032.
(SEQ ID NO: 12)
41. The process of claim 23, wherein said probe is a TaqMan probe having the sequence of 5\u2032 FAM-TTTGATCCCTGGCCTTGCTCAGTGG-TAMRA 3\u2032 (5\u2032 FAM-SEQ ID NO: 9 -TAMRA 3\u2032).