Author: claimsbot

1. A process for preparing a pharmaceutical composition comprising an ibuprofen shell completely surrounding a coated core tablet wherein the coated core tablet comprises famotidine and a barrier layer, wherein said process comprises
blending a therapeutically effective amount of famotidine with at least one pharmaceutically acceptable excipient to yield a blended famotidine mixture;
pressing said blended famotidine mixture;
coating said pressed blended famotidine mixture with a barrier layer to yield a coated core tablet;
blending a therapeutically effective amount of ibuprofen with at least one pharmaceutically acceptable excipient to yield a blended ibuprofen mixture;
granulating said blended ibuprofen mixture to yield a granulated ibuprofen; and
compressing said granulated ibuprofen around the coated core tablet to yield an ibuprofen shell such that the ibuprofen shell completely surrounds the coated core tablet.
2. The process of claim 1, wherein the core tablet comprises from about 6.9 wt % to about 7.9 wt % of the total weight of the pharmaceutical composition.
3. The process of claim 1, wherein the coated core tablet comprises from about 7.4 wt % to about 8.4 wt % of the total weight of the pharmaceutical composition.
4. The process of claim 1, wherein the ibuprofen shell comprises from about 91.6 wt % to about 92.6 wt % of the total weight of the pharmaceutical composition.
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. The process of claim 1, wherein the pharmaceutical composition comprises from about 24 mg to about 28 mg famotidine.
10. The process of claim 9, wherein the pharmaceutical composition comprises about 26.6 mg famotidine.
11. The process of claim 1, wherein the pharmaceutical composition comprises from about 750 mg to about 850 mg ibuprofen.
12. The process of claim 11, wherein the pharmaceutical composition comprises about 800 mg ibuprofen.
13. The process of claim 1, wherein the barrier layer comprises Opadry white.
14. (canceled)
15. A pharmaceutical composition prepared by a process of claim 1.
16. A pharmaceutical composition comprising:
a first compartment comprising
a therapeutically effective amount of famotidine;
from about 42 mg to about 46 mg of microcrystalline cellulose;
from about 10 mg to about 19 mg of at least one binder other than microcrystalline cellulose; and
from about 0.9 mg to about 1.9 mg of at least one lubricant, and

a second compartment comprising
a therapeutically effective amount of ibuprofen;
from about 200 to about 250 mg of at least one binder; and
from about 2.5 mg to about 3.5 mg of at least one lubricant,

wherein said first compartment is separated from said second compartment.
17. The pharmaceutical composition of claim 16, wherein the pharmaceutical composition is in the form of a tablet.
18. The pharmaceutical composition of claim 17, wherein said pharmaceutical composition comprises a coated core tablet and a shell completely surrounding the coated core tablet,
wherein the coated core tablet comprises a barrier layer coating and a core tablet coated with the barrier layer and
wherein the core tablet comprises the first compartment and the shell comprises the second compartment.
19. The pharmaceutical composition of claim 16, wherein the first compartment comprises
from about 24 mg to about 28 mg famotidine;
from about 42 mg to about 46 mg of microcrystalline cellulose;
from about 10 mg to about 19 mg of at least one binder other than microcrystalline cellulose; and
from about 0.9 mg to about 1.9 mg of at least one lubricant.
20. The pharmaceutical composition of claim 16 wherein the second compartment comprises
from about 750 mg to about 850 mg ibuprofen;
from about 200 to about 250 mg of at least one binder; and
from about 2.5 mg to about 3.5 mg of at least one lubricant.
21. The pharmaceutical composition of claim 17, wherein the first compartment corresponds to a first layer of the pharmaceutical composition and the second compartment corresponds to a second layer of the pharmaceutical composition, wherein the first layer and the second layer are separated by a barrier layer.
22. The pharmaceutical composition of claim 17, wherein the first compartment corresponds to a first layer of the pharmaceutical composition, a portion of the second compartment corresponds to a second layer of the pharmaceutical composition adjacent to a first side of said first layer, and the remainder of the second compartment corresponds to a third layer of the pharmaceutical composition adjacent to a second side of the first layer.
23. The pharmaceutical composition of claim 16, wherein the pharmaceutical composition is in the form of a soft gel capsule.
24. The pharmaceutical composition of claim 16, wherein the pharmaceutical composition is in the form of a hard gel capsule.
25. The pharmaceutical composition of claim 16, wherein the pharmaceutical composition is in a chewable form.
26. The pharmaceutical composition of claim 16, wherein the pharmaceutical composition is in a form that dissolves andor disintegrates orally.
27. (canceled)
28. (canceled)
29. The pharmaceutical composition of claim 16, wherein the second compartment comprises from about 775 mg to about 825 mg of ibuprofen.
30. The pharmaceutical composition of claim 29, wherein the pharmaceutical composition comprises about 800 mg ibuprofen.
31. The pharmaceutical composition of claim 16, wherein the pharmaceutical composition comprises about 26.6 mg famotidine.
32. A method for reducing the risk of developing ibuprofen-induced ulcers in a human subject requiring ibuprofen for an ibuprofen-responsive condition comprising administering to the human subject a pharmaceutical composition of claim 16.
33. (canceled)
34. (canceled)
35. A method for reducing gastric acid while treating a subject with an ibuprofen-responsive condition comprising prescribing or administering to the subject a pharmaceutical composition of claim 16.
36. (canceled)
37. A method of reducing symptoms of a famotidine-responsive condition in a subject in need of NSAID treatment who has experienced symptoms of a famotidine-responsive condition associated with NSAID administration, comprising prescribing or administering a pharmaceutical compositions of claim 16.
38. (canceled)
39. The method of claim 32 further comprising, prior to administering the pharmaceutical composition, determining an approximate serum creatinine concentration for the subject; if the subject has a creatinine clearance rate of greater than about 50 mLminute, then prescribing or administering a first dose of the pharmaceutical composition.
40. The method of claim 32, further comprising prior to administering the pharmaceutical composition, determining if the subject is being administered one or more additional therapeutic agents chosen from diuretics, angiotensin converting enzyme inhibitors, and angiotensin receptor blockers, if the subject is being administered one or more of said additional therapeutic agents, then determining an approximate creatinine clearance rate for the individual; then if the subject has a creatinine clearance rate of greater than about 50 mLminute, prescribing or administering a first dose of a pharmaceutical composition.
41. A method for reducing the risk of an adverse event in an subject requiring ibuprofen for an ibuprofen-responsive comprising:
a) determining an approximate serum creatinine concentration for the individual;
b) if the subject has a creatinine clearance rate of greater than about 50 mLminute, then prescribing or administering a first dose of a pharmaceutical composition of claim 16;
c) prescribing or administering to the subject a second dose of the pharmaceutical composition; and
d) prescribing or administering to the subject a third dose of the pharmaceutical composition.
42. A method for the treatment of cystic fibrosis comprising prescribing or administering a pharmaceutical composition of claim 16.
43. The method of claim 32 wherein the pharmaceutical composition is administered three times a day (TID).

The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.

What is claimed is:

1. An applicator for applying and distributing a substance onto a target surface, said applicator comprising:
(a) a substantially planar sheet of compressible, conformable material having opposed first and second surfaces and an interior region between said first and second surfaces, said sheet of material having a thickness between said first and second surfaces which decreases when said sheet of material is subjected to an externally-applied force in a direction substantially normal to said first surface;
(b) at least one discrete reservoir extending inwardly of said first surface into the interior of said sheet of material;
(c) a substance at least partially filling said reservoir; and
(d) at least one discrete aperture formed in said first surface, said aperture being in fluid communication with said reservoir;
whereby compression of said sheet of material via an externally-applied force substantially normal to said first surface expresses said product from said aperture and translational motion of said first surface relative to a target surface applies and distributes said product onto said target surface.
2. The applicator of claim 1, wherein said applicator includes a plurality of apertures forming a delivery zone adjacent to one end of said applicator.
3. The applicator of claim 1, wherein said substance fills said reservoir to a level at least equal to said first surface.
4. The applicator of claim 1, wherein said reservoir defines an interior volume which decreases when said thickness is reduced by an externally-applied force.
5. The applicator of claim 1, wherein said applicator includes a plurality of apertures.
6. The applicator of claim 1, wherein said applicator includes a plurality of reservoirs.
7. The applicator of claim 1, wherein said applicator includes a plurality of apertures and a corresponding plurality of reservoirs, each of said apertures being in fluid communication with one of said reservoirs.
8. The applicator of claim 1, wherein said aperture fully penetrates said first and second surfaces and said reservoir is formed between said second surface and a backing sheet peripherally joined thereto.
9. The applicator of claim 1, wherein said reservoir extends inwardly of said first surface into the interior of said sheet of material but does not penetrate said second surface.
10. The applicator of claim 1, wherein said reservoir extends inwardly of said first surface into the interior of said sheet of material a distance which is less than said thickness.
11. The applicator of claim 1, wherein said sheet material is resilient in compression.
12. The applicator of claim 1, wherein said sheet material is resilient in bending.
13. The applicator of claim 1, wherein said sheet material comprises a closed-cell foam material.
14. The applicator of claim 1, wherein said applicator includes a removable cover sheet for enclosing said aperture prior to use.
15. The applicator of claim 1, wherein said applicator includes a plurality of reservoirs and a corresponding plurality of apertures, and wherein said reservoirs include multiple diverse substances.
16. An applicator for applying and distributing a substance onto a target surface, said applicator comprising:
(a) a substantially planar sheet of compressible, conformable material having opposed first and second surfaces and an interior region between said first and second surfaces;
(b) at least one discrete aperture extending inwardly of said first surface into the interior of said sheet of material a distance which is less than the distance between said opposed first and second surfaces to form a corresponding product reservoir.
17. The applicator of claim 16, wherein said compressible, conformable material comprises a closed-cell foam material.
18. A method of making an applicator for applying and distributing a substance onto a target surface, said method comprising the steps of:
(a) providing a substantially planar sheet of compressible, conformable material having opposed first and second surfaces and an interior region between said first and second surfaces, said sheet of material having a thickness between said first and second surfaces which decreases when said sheet of material is subjected to an externally-applied force in a direction substantially normal to said first surface;
(b) forming at least one discrete reservoir extending inwardly of said first surface into the interior of said sheet of material;
(c) at least partially filling said reservoir with a substance; and
(d) forming at least one discrete aperture in said first surface, said aperture being in fluid communication with said reservoir.
19. The method of claim 18, wherein said reservoir is formed by thermal embossing.
20. The method of claim 18, wherein said substance is injected into said reservoir.
21. The applicator of claim 1, wherein said reservoir is a slot type reservoir.
22. The applicator of claim 1, wherein said reservoir is an aperture-channel type reservoir.
23. The applicator of claim 1, wherein said reservoir is an aperture-channel type reservoir positioned diagonally at a 45 angle.
24. The applicator of claim 1, wherein said reservoir has an aspect ratio of about 5 or below.

1. A vertical cavity surface emitting laser comprising:
a lower distributed Bragg reflector;
an active region positioned on the lower distributed Bragg reflector;
an upper distributed Bragg reflector positioned on the active region;
a cylindrical volume removed from the upper distributed Bragg reflector defining a mesa with a substantially vertical side wall concentrically surrounded by the cylindrical volume, an isolation trench formed in a lower surface of the cylindrical volume concentric with the mesa;
an implant region including a portion of the side wall of the mesa and a portion of the upper distributed Bragg reflector below the lower surface of the cylindrical volume;
a planarizing material filling the cylindrical volume; and
n and p electrical contacts coupled to opposite sides of the active region for supplying operating current thereto;
wherein the lower surface of the cylindrical volume is formed so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases.
2. A vertical cavity surface emitting laser as claimed in claim 1 wherein the lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa.
3. A vertical cavity surface emitting laser as claimed in claim 1, wherein the implant region in the lower surface of the cylindrical volume extends at least into the active region adjacent the isolation trench.
4. A vertical cavity surface emitting laser as claimed in claim 1 wherein the planarizing material filling the cylindrical volume includes a low-k dielectric material.
5. A vertical cavity surface emitting laser as claimed in claim 1 wherein the implant region includes as least some of the cylindrical volume surface.
6. A vertical cavity surface emitting laser as claimed in claim 1 wherein the implant region includes proton implants.
7. A vertical cavity surface emitting laser as claimed in claim 1, wherein implant region in the lower surface of the cylindrical volume extends into the lower distributed Bragg reflector.
8. A vertical cavity surface emitting laser comprising:
a lower distributed Bragg reflector including a plurality of pairs of mirror elements;
an active region positioned on the lower distributed Bragg reflector;
an upper distributed Bragg reflector including a plurality of pairs of mirror elements positioned on the active region;
a cylindrical volume removed from the upper distributed Bragg reflector defining a mesa with a substantially vertical side wall concentrically surrounded by the cylindrical volume, an isolation trench formed in a lower surface of the cylindrical volume concentric with the mesa, the lower surface of the cylindrical volume, being formed so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases whereby the lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa;
an implant region adjacent a surface of the cylindrical volume including the side wall of the mesa and the upper distributed Bragg reflector defining the lower surface of the cylindrical volume;
a planarizing material filling the cylindrical volume; and
n and p electrical contacts coupled to opposite sides of the active region for supplying operating current thereto.
9. A method of fabricating a high frequency vertical cavity surface emitting laser comprising the steps of:
a) providing a lower distributed Bragg reflector on a substrate, an active region on the lower distributed Bragg reflector, and an upper distributed Bragg reflector on the active region;
b) etching a cylindrical volume from the upper distributed Bragg reflector to define a mesa with a substantially vertical side wall, the cylindrical volume extending into the upper distributed Bragg reflector to a lower surface adjacent the active region;
c) etching an isolation trench in the lower surface of the cylindrical volume concentric with the mesa and extending through the active region;
d) implanting a portion of the side wall of the mesa and the lower surface of the cylindrical volume; and
e) planarizing the upper distributed Bragg reflector and coupling n and p electrical contacts to opposite sides of the active region for supplying operating current thereto;
wherein step b) includes etching the cylindrical volume so that the lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa, and etching the cylindrical volume so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases.
10. The method of claim 9, wherein step d) includes proton implanting the side wall of the mesa and the lower surface of the cylindrical volume.
11. The method of claim 10, wherein step d) includes implanting the lower surface of the cylindrical volume so that the implant extends at least into the active region adjacent the isolation trench.
12. The method of claim 10, wherein step d) includes implanting the lower surface of the cylindrical volume so that the implant extends into the lower distributed Bragg reflector adjacent the isolation trench.
13. The method of claim 9, wherein step a) includes epitaxially growing the lower distributed Bragg reflector on the substrate, epitaxially growing the active region on the lower distributed Bragg reflector, and epitaxially growing the upper distributed Bragg reflector on the active region.
14. The method of claim 9, wherein step e) includes filling the cylindrical volume with one of benzocyclobutene (BCB) dielectric and a polyimide material.
15. A method of fabricating a high frequency vertical cavity surface emitting laser comprising the steps of:
epitaxially growing a lower distributed Bragg reflector on a substrate, epitaxially growing an active region on the lower distributed Bragg reflector, and epitaxially growing an upper distributed Bragg reflector on the active region;
etching a cylindrical volume from the upper distributed Bragg reflector to define a mesa with substantially vertical side wall, the upper distributed Bragg reflector being etched so that a lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa, and further etching the cylindrical volume so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases;
etching an isolation trench in the lower surface of the cylindrical volume concentric with the mesa and extending through the active region;
proton implanting a portion of the side wall of the mesa and the lower surface of the cylindrical volume; and
planarizing the upper distributed Bragg reflector and coupling n and p electrical contacts to opposite sides of the active region for supplying operating current thereto.
16. The method of claim 15 wherein the step of proton implanting the lower surface of the cylindrical volume includes implanting the lower surface of the cylindrical volume so that the implant extends at least into the active region adjacent the isolation trench.
17. The method of claim 15 wherein the step of planarizing includes filling the cylindrical volume with one of BCB dielectric and a polyamide.
18. A vertical cavity surface emitting laser comprising:
a lower distributed Bragg reflector including a plurality of pairs of mirror elements;
an active region positioned on the lower distributed Bragg reflector;
an upper distributed Bragg reflector including a plurality of pairs of mirror elements positioned on the active region;
a cylindrical volume removed from the upper distributed Bragg reflector defining a mesa with a substantially vertical side wall concentrically surrounded by the cylindrical volume, the lower surface of the cylindrical volume being formed so that more mirror pairs of the upper distributed Bragg reflector remain adjacent the mesa and less mirror pairs remain as the lateral distance from the mesa increases whereby the lower surface of the cylindrical volume forms an angle greater than ninety degrees with the side wall of the mesa;
an implant region adjacent a surface of the cylindrical volume including the side wall of the mesa and the upper distributed Bragg reflector defining the lower surface of the cylindrical volume;
a planarizing material filling the cylindrical volume; and
n and p electrical contacts coupled to opposite sides of the active region for supplying operating current thereto.
19. A vertical cavity surface emitting laser as claimed in claim 18, wherein the implant region in the lower surface of the cylindrical volume extends at least into the active region.
20. A vertical cavity surface emitting laser as claimed in claim 18, wherein implant region in the lower surface of the cylindrical volume extends into the lower distributed Bragg reflector.

The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.

1. A process for assaying a product sample in which material may be present that emanates from a particular type of animal selected from the group consisting of porcine species, and a ruminant as source, in order to determine, qualitatively or quantitatively, whether or the extent to which material from the particular type of animal is present in the product sample, said process comprising the following steps:
(1) providing a product sample to be assayed;
(2) extracting or isolating a DNA sample from the product sample;
(3) carrying out a polymerase chain reaction (PCR) on said DNA sample with a primer pair to produce an amplified DNA product representative of a predetermined short interspersed element (SINE) selected from the group consisting of PRE-1 SINE of the porcine species, and a Bovine SINE family of the ruminant, said predetermined SINE when present in the DNA sample being a marker specific for the particular type of animal, said predetermined SINE selected from a genomic subset common to members of the particular type of animal and not found in genomes of other types of animal,
the primer pair for the PRE-1 SINE of the porcine species comprising at least one of the primer pair (i) and the primer pair (ii), the primer pair (i) comprising:
a forward primer containing the sequence:
5\u2032\u2003GACTAGGAACCATGAGGTTGCG 3\u2032;
(SEQ ID NO: 3)
and

a reverse primer containing the sequence:
5\u2032\u2003AGCCTACACCACAGCCACAG 3\u2032;
(SEQ ID NO: 4)
the primer pair (ii) comprising:
a forward primer containing the sequence:
5\u2032\u2003GGCCTTGCTCAGTGGGTTAA 3\u2032;
(SEQ ID NO: 10)
and

a reverse primer containing the sequence:
5\u2032\u2003GGGATCCAAGCCACATCTGT 3\u2032
(SEQ ID NO: 11)
the primer pair for the Bovine SINE family of the ruminant comprising:
a forward primer containing the sequence:
5\u2032\u2003CAGTCGTGTCCGACTCTTTGT 3\u2032;
(SEQ ID NO: 7)
and

a reverse primer containing the sequence:
5\u2032\u2003AATGGCAACACGCTTCAGTATT 3\u2032;
(SEQ ID NO: 8)
and
(4) determining whether, or the extent to which, the predetermined amplicon is present in the amplified DNA product.
2. (canceled)
3. The process of claim 1, wherein the determination of presence of the predetermined amplicon in the amplified DNA product comprises:
performing electrophoresis for a predetermined duration of time at a predetermined voltage gradient, on a gel containing said DNA sample stained with ethidium bromide; and
examining the gel under UV light for fluorescence after the predetermined duration of time.
4. The process of claim 1, wherein the determination of presence of the predetermined amplicon in the amplified DNA product comprises:
adding SYBR Green dye in the PCR amplification step to provide a fluorescent signal; and
then evaluating the fluorescent signal for a PCR cycle at which it crosses a baseline.
5. The process of claim 1, wherein the determination of presence of the predetermined amplicon in the amplified DNA product comprises:
adding a fluorogenic probe in the PCR amplification step; and
then evaluating a fluorescent signal for a PCR cycle at which it crosses a baseline.
6. The process of claim 1, wherein the particular type of animal is a member of the order Artiodactyla and the predetermined amplicon is no longer than 140 bp.
7. The process of claim 6, wherein the member of the order Artiodactyla is a member of the family Suidae, and the predetermined amplicon is representative of porcine PRE-1 SINE.
8. The process of claim 7, wherein the polymerase chain reaction uses the primers comprising:
the forward primer containing the sequence:
5\u2032\u2003GACTAGGAACCATGAGGTTGCG 3\u2032,;
(SEQ ID NO: 3)
and
the reverse primer containing the sequence:
5\u2032\u2003AGCCTACACCACAGCCACAG 3\u2032.
(SEQ ID NO: 4)
9. The process of claim 7, wherein the determination of presence of the predetermined amplicon comprises SYBR Green-based detection and wherein an assay is provided having a minimum effective quantitation level better than 0.1 pg (0.0005% in 20 ng).
10. The process of claim 7, wherein the determination of presence of the predetermined amplicon comprises using a probe containing the sequence:
5\u2032\u2003TTTGATCCCTGGCCTTGCTCAGTGG 3\u2032.
(SEQ ID NO: 9)
11. The process of claim 6, wherein the polymerase chain reaction uses primers comprising:
a forward primer containing the sequence:
5\u2032\u2003GGCCTTGCTCAGTGGGTTAA 3\u2032;
(SEQ ID NO: 10)
and
a reverse primer containing the sequence:
5\u2032\u2003GGGATCCAAGCCACATCTGT 3\u2032.
(SEQ ID NO: 11)
12. The process of claim 6, wherein:
the member of the order Artiodactyla is a member of the suborder Ruminantia; and
the predetermined amplicon is no longer than 110 bp.
13. The process of claim 12, wherein the SINE is intra-Bov-tA2 SINE.
14. The process of claim 12, wherein the polymerase chain reaction uses the primers comprising:
the forward primer containing the sequence:
5\u2032\u2003CAGTCGTGTCCGACTCTTTGT 3\u2032;
(SEQ ID NO: 7)
and
the reverse primer containing the sequence:
5\u2032\u2003AATGGCAACACGCTTCAGTATT 3\u2032.
(SEQ ID NO: 8)
15-19. (canceled)
20. A process for assaying a meat sample of unknown content to determine the presence of pork in the sample, said process comprising the steps of:
(1) extracting a DNA sample from the meat sample to be assayed;
(2) adding to the DNA sample a primer pair
selected from the group consisting of (i) a forward primer containing the sequence of 5\u2032 GACTAGGAACCATGAGGTTGCG 3\u2032 (SEQ ID NO: 3) and a reverse primer containing the sequence of 5\u2032 AGCCTACACCACAGCCACAG 3\u2032 (SEQ ID NO: 4) and (ii) a forward primer containing the sequence of 5\u2032 GGCCTTGCTCAGTGGGTTAA 3\u2032 (SEQ ID NO: 10) and a reverse primer containing the sequence of 5\u2032 GGGATCCAAGCCACATCTGT 3\u2032 (SEQ ID NO:11),

whereby a pre-PCR mixture is provided;
(3) carrying out a polymerase chain reaction (PCR) on the pre-PCR mixture, whereby an amplified DNA product results;
(4) determining presence in the amplified DNA product of an amplicon representative of porcine PRE-1 SINE.
21. The process of claim 20, wherein the determination of presence of the predetermined amplicon comprises:
performing electrophoresis for a predetermined duration of time at a predetermined voltage gradient, on a gel containing said DNA sample stained with ethidium bromide; and
examining the gel under UV light for fluorescence after the predetermined duration of time.
22. The process of claim 20, wherein the determination of presence of the predetermined amplicon comprises SYBR Green-based detection.
23. The process of claim 20, wherein the primer pair is the SEQ ID NO: 3 and the SEQ ID NO: 4, and the determination of presence of the predetermined amplicon comprises:
adding a fluorogenic probe, said probe comprising the sequence of 5\u2032 TTTGATCCCTGGCCTTGCTCAGTGG 3\u2032 (SEQ ID NO: 9), in the PCR amplification step; and
then evaluating a fluorescent signal for a PCR cycle at which it crosses a baseline.
24. A process for assaying a sample of unknown content to determine the presence of ruminant-source material in the sample, said process comprising the steps of:
(1) extracting a DNA sample from the sample to be assayed;
(2) adding to the DNA sample a primer pair wherein the forward primer contains the sequence:
5\u2032CAGTCGTGTCCGACTCTTTGT3\u2032,
(SEQ ID NO: 7)
and the reverse primer contains the sequence:
5\u2032AATGGCAACACGCTTCAGTATT3\u2032,
(SEQ ID NO: 8)
whereby a pre-PCR mixture is provided;
(3) carrying out a polymerase chain reaction (PCR) on the pre-PCR mixture, whereby an amplified DNA product results;
(4) determining presence in the amplified DNA product of a predetermined amplicon representative of Bov-tA2 SINE.
25. The process of claim 24, wherein the determination of presence of the predetermined amplicon comprises:
performing electrophoresis for a predetermined duration of time at a predetermined voltage gradient, on a gel containing ethidium bromide; and
examining the gel under UV light for fluorescence after the predetermined duration of time.
26. The process of claim 24, wherein the determination of presence of the predetermined amplicon comprises:
adding SYBR Green dye in the PCR amplification step to provide a fluorescent signal; and
then evaluating the fluorescent signal for a PCR cycle at which it crosses a baseline.
27-38. (canceled)
39. The process of claim 10, wherein said probe is a TaqMan probe having the sequence of 5\u2032 FAM-TTTGATCCCTGGCCTTGCTCAGTGG-TAMRA 3\u2032 (5\u2032 FAM-SEQ ID NO: 9 -TAMRA 3\u2032).
40. The process of claim 11, wherein the determination of presence of the predetermined amplicon comprises using a probe containing the sequence:
5\u2032\u2003ACAGCTCACGGCAACGCCGG 3\u2032.
(SEQ ID NO: 12)
41. The process of claim 23, wherein said probe is a TaqMan probe having the sequence of 5\u2032 FAM-TTTGATCCCTGGCCTTGCTCAGTGG-TAMRA 3\u2032 (5\u2032 FAM-SEQ ID NO: 9 -TAMRA 3\u2032).