Author: claimsbot

1. A shielded, low-noise, high-voltage power supply, comprising:
a plurality of voltage multipliers, each having a toroidal transformer, and collectively producing a DC output voltage from an AC voltage;
a main conductor for carrying the AC voltage, positioned proximate each toroidal transformer of the plurality of voltage multipliers;
a conductive shell conductively connected to the main conductor, and substantially enclosing the plurality of voltage multipliers and the main conductor, the conductive shell providing a return path for the AC voltage in the main conductor and providing EMI shielding of the voltage multipliers and the main conductor.
2. The power supply of claim 1, further comprising an insulating potting material surrounding the main conductor and the voltage multipliers.
3. The power supply of claim 2, wherein the main conductor is unsheathed.
4. The power supply of claim 1, wherein the main conductor is about \xbc inches in diameter.
5. The power supply of claim 1, further comprising:
an AC drive circuit for producing the AC voltage; and
an intermediate transformer, positioned between the AC drive circuit and the main conductor, for conditioning the AC voltage prior to its application to the main conductor, and for isolating the main conductor from the AC drive circuit.
6. The power supply of claim 5, wherein the intermediate transformer is positioned on a board forming part of the conductive shell, and proximate one end of the main conductor.
7. The power supply of claim 1, wherein the conductive shell is grounded.
8. The power supply of claim 1, wherein the conductive shell comprises an exterior housing of the power supply.
9. The power supply of claim 1, wherein the conductive shell comprises a layer positioned inside of an exterior housing of the power supply.
10. An x-ray analysis engine in combination with the power supply of claim 1, the x-ray analysis engine having an x-ray source connected to the power supply.
11. The combination of claim 10, further comprising at least one x-ray optic disposed in an x-ray excitation andor detection path, requiring alignment to a focal spot.
12. The combination of claim 11, wherein the at least one x-ray optic comprises a curved monochromating optic or a polycapillary optic.
13. The combination of claim 10, comprising a detector which requires EMI shielding from components within the power supply.

The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.

1. A multi-ratio transmission system with parallel vertical and coaxial planet gears, comprising:
a plurality of planet gear sub-systems, being coaxially disposed in series along a first axis, each of said planet gear sub-system comprising:
a sun gear, being coaxially disposed along said first axis, wherein said sun gear rotates around said first axis optionally; and
at least one planet gear, being coaxially disposed along a second axis which is vertical to said first axis, wherein said at least one planet gear rotates around said second axis;
a coupling assembly disposed between every two adjacent said planet gear sub-systems so as to transmit rotation of said planet gear of the former said planet gear sub-system to said planet gear of the latter said planet gear sub-system;
a setting element disposed corresponding to each of said planet gear sub-systems, wherein said setting element optionally moves in the direction of said first axis so as to optionally engage with said sun gear of said planet gear sub-system;
a setting element controller, having a hollowed tube disposed coaxially with said first axis to rotate around said first axis within a range of predetermined angles, wherein said hollowed tube has an outer circumferential surface, and a cam groove is formed on said outer circumferential surface in the circumferential direction corresponding to each of said setting element of said planet gear sub-system, thereby allowing said setting element to optionally move along said first axis and to optionally engage with said sun gears of said planet gear sub-systems;
an annular gear engaged to said planet gear of at least one of said planet gear sub-system, wherein said annular gear is installed onto a one-way clutch;
a cylindrical casing enclosing said planet gear sub-systems, wherein said annular gear is secured at a front end of said cylindrical casing;
a sprocket, installed onto said one-way clutch, wherein an external transmission system is connected with said sprocket to drive said planet gear sub-systems to rotate through said one-way clutch and said annular gear; and
a central axle, being disposed coaxially with said first axis, wherein said central axle is inserted into a center through hole of said hollowed tube of said setting element controller by relative rotation, thereby enabling said hollowed tube to rotate around said central axle.
2. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein said second axes of said planet gears of said planet gear sub-systems are configured to be parallel to one another.
3. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein said sun gear of each of said planet gear sub-systems includes an outer gear, which is a bevel gear, and said planet gear of each said planet gear sub-system is a bevel gear engaging with said outer gear of said sun gear.
4. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 3, wherein said sun gear further includes an inner gear, and said setting element is a crown gear, which optionally engages with said inner gear of said sun gear.
5. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein said sun gear of each planet gear sub-system includes an outer gear and an inner gear which are coaxially connected to each other, said outer gear is located at the outer side of said inner gear and is a bevel gear, said planet gear of said planet gear sub-system is a bevel gear, which is engaged with said outer gear of said sun gear, and said setting element is a crown gear, which optionally engages with said inner gear of said sun gear.
6. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein each planet gear sub-system has two planet gears, which are disposed opposite to each other.
7. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein said coupling assembly includes:
two pulleys, connected to said planet gears of said two adjacent planet gear sub-systems respectively, and being rotated in synchronization with said planet gears respectively; and
a belt trained around said two pulleys so as to connect said two pulleys.
8. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein said central axle has two ends, said two ends of said central axle are secured on a bicycle rack respectively.
9. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 8, wherein two flat surfaces are formed opposite to each other on each end of said central axle, said two flat surfaces of said central axle are engaged with two corresponding flat surfaces of said bicycle rack to prevent relative rotation between said central axle and said bicycle rack.
10. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein said setting element controller further includes a rotation controller, said rotation controller is installed onto an end of said hollowed tube so as to optionally rotate said hollowed tube in said range of predetermined angles.
11. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein said setting element includes a hollowed cylinder, a plurality of teeth is formed on a side end of said hollowed cylinder, and said hollowed cylinder is disposed coaxially with said sun gear of said planet gear sub-system in such way that said hollowed cylinder moves along said first axis corresponding to said sun gear, thereby allowing said teeth to optionally engage with said sun gear; said hollowed cylinder includes a control pin, wherein a free end of said control pin is inserted into said cam groove to move along said cam groove.
12. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein an outer thread is formed on a side circumferential surface of said annular gear, an inner thread is formed on an inner circumferential surface of said cylindrical casing at a front end thereof, and said inner thread is engaged with said outer thread so as to secure said annular gear at said front end of said cylindrical casing.
13. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1 further includes another said annular gear, wherein the other said annular gear is secured at a rear end of said cylindrical casing opposite to said front end, said annular gear and the other said annular gear are engaged with said planet gear of a first and a last planet gear sub-systems of said plurality of planet gear sub-systems respectively; wherein said first and said last planet gear sub-systems further include a transmission gear, which is coaxially connected to said planet gear to engage with said annular gear.
14. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 13, wherein the other said annular gear has an axial end, a flange is inwardly formed at said front end of said cylindrical casing, said other annular gear is rotatably fitted at said rear end of said cylindrical casing by abutting said flange of said cylindrical casing against said axial end of said other annular gear.
15. (canceled)
16. (canceled)
17. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 14, wherein an outer thread is formed on a side circumferential surface of said annular gear engaging with said planet gear of said first planet gear sub-system, an inner thread is formed on an inner circumferential surface of said cylindrical casing at a front end thereof, and said inner thread is engaged with said outer thread so as to secure said annular gear at said front end of said cylindrical casing.
18. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein each planet gear sub-system includes an annular base, a circular wall structure is formed on said annular base surrounding said setting element and said planet gear of said planet gear sub-system while being disposed coaxially with said first axis; wherein a hole is formed on said annular base for rotatably fitting and supporting an axle of said planet gear.
19. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 18, wherein each said annular base of said planet gear sub-systems is formed with two axial ends, and said axial ends of said annular bases are abutted against each other in the direction of said first axis.
20. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 19, wherein at least one axial groove is formed on an outer side surface of each said annular base, said axial groove extends from one of said axial ends of said annular base to another said axial end thereof for tightly fitting a securing rod inside so as to prevent relative rotation between said annular bases.
21. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 10, wherein said rotation controller is installed onto a shift cable connector for connecting to a shift cable, said rotation controller and said hollowed tube installed onto said rotation controller are driven to rotate around said first axis by pulling said shift cable.
22. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 21, wherein a connecting hole is formed on said rotation controller for inserting an inner axial pin of said shift cable connector.
23. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 21 further includes a shift-guiding component inserted and connected to said central axle, wherein a circular guiding groove is formed coaxially with said first axis on said shift-guiding component, said shift cable connector has an outer axial pin which is slidably inserted into said circular guiding groove; wherein said circular guiding groove extends for a range of angles in the circumferential direction corresponding to said range of predetermined angles of the rotation of said hollowed tube of said setting element controller.
24. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 23, wherein an insertion hole is formed at the center of said shift-guiding component, and the two sides of said insertion hole are formed as two flat walls for abutting against said flat surfaces of said central axle, thereby preventing relative rotation between said central axle and said shift-guiding component.
25. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 1, wherein said one-way clutch includes:
a clutch casing integrally formed with said annular gear, wherein said clutch casing has an annular protrusion for installing said sprocket, and at least one pin-fitting hole is formed on said annular protrusion; and
at least one pin set fitted inside said pin-fitting hole, wherein said pin set includes a pin, which is constantly pushed outward by a spring to engage with one of a plurality of engaging holes formed on said sprocket, and is retracted from said engaging hole by an external force.
26. The multi-ratio transmission system with parallel vertical and coaxial planet gears according to claim 25, wherein said engaging holes of said sprocket are distributed along a circle, which is coaxial to said first axis, with equal angular intervals in between every two adjacent engaging holes; wherein each engaging hole has a flat surface and an oblique surface opposite to said flat surface, said flat surface is abutted against said pin to transmit force in a given rotation direction, said oblique surface serves as a cam and guides said pin outside said engaging hole upon contact to avoid force transmission in a rotation direction opposite to said given rotation direction

What is claimed is:

1. A substrate provided with a layer of aligned fine particles,
wherein an organic coating film bonded to a surface of the fine particle is formed on the surface of the fine particle,
an organic coating film bonded to a surface of the substrate is formed on the surface of the substrate, and
the organic coating film on the surface of the fine particle is bonded to the organic coating film on the surface of the substrate, whereby the fine particles are immobilized and aligned on the substrate.
2. The substrate provided with a layer of aligned fine particles according to claim 1, wherein an alignment of the fine particles is a single layer of an assembly film.
3. The substrate provided with a layer of aligned fine particles according to claim 1, wherein the fine particles are aligned in form of accumulated layers, and the fine particles are bonded to each other and immobilized.
4. The substrate provided with a layer of aligned fine particles according to claim 1, wherein an average diameter of the fine particles is in a range from 0.5 nm or more to 50 nm or less.
5. The substrate provided with a layer of aligned fine particles according to claim 1, wherein at least one of the organic coating film on the surfaces of the fine particles and the organic coating film on the surface of the substrate is a self-assembling film.
6. The substrate provided with a layer of aligned fine particles according to claim 1, wherein the fine particles are patterned and aligned on the surface of the substrate.
7. The substrate provided with a layer of aligned fine particles according to claim 1, wherein the fine particles are aligned in a concave portion of a concave and convex pattern formed on the surface of the substrate.
8. The substrate provided with a layer of aligned fine particles according to claim 7, wherein a width of the concave portion is not less than five times and not more than 30 times the average diameter of the fine particle.
9. The substrate provided with a layer of aligned fine particles according to claim 1, wherein the organic coating film on the surface of the fine particle is bonded to the organic coating film on the surface of the substrate with at least one binding selected from the group consisting of covalent bonding, ion bonding, coordinate binding and intermolecular force binding.
10. The substrate provided with a layer of aligned fine particles according to claim 1, wherein the fine particles are at least one selected from the group consisting of metal, metal oxide, semiconductor, an amphoteric element, amphoteric element oxide, and resin.
11. The substrate provided with a layer of aligned fine particles according to claim 1, wherein the fine particles are fine magnetic particles.
12. The substrate provided with a layer of aligned fine particles according to claim 1, wherein
the substrate is formed of at least one material selected from the group consisting of metal, metal oxide, semiconductor, an amphoteric element, amphoteric element oxide, and resin.
13. A method for producing aligned fine particles on a substrate comprising:
forming an organic coating film on a surface of the individual fine particle,
forming an organic coating film on a surface of the substrate, and
allowing the organic coating film on the surface of the fine particle to be in contact with the organic coating film on the surface of the substrate to form a bond between the two organic coating films.
14. The method for producing aligned fine particles-according to claim 13,
wherein the process of forming a bond between the organic coating film on the surface of the fine particle and the organic coating film on the surface of the substrate comprises:
irradiating the organic coating film formed on the substrate to form a chemically reactive group in the organic coating film in the irradiated portion, and
forming a chemical bond with the organic coating film on the surface of the fine particle.
15. The method for producing aligned fine particles according to claim 13,
wherein the process of forming a bond between the organic coating film on the surface of the fine particle and the organic coating film on the surface of the substrate comprises:
irradiating the organic coating film formed on the substrate,
removing the organic coating film in the irradiated portion and forming a chemical bond between the organic coating film in a remaining portion on the surface of the substrate and the organic coating film on the surface of the fine particle.
16. The method for producing aligned fine particles according to claim 13,
wherein the process of forming a bond between the organic coating film on the surface of the fine particle and the organic coating film on the surface of the substrate comprises:
irradiating partially the organic coating film formed on the surface of the substrate to form a chemically reactive group in the organic coating film in the irradiated portion to form a chemical bond with the organic coating film on the surface of the fine particle, thereby aligning the fine particles only in the energy ray irradiated portion,
irradiating a second portion that had not been irradiated anew to form a chemically reactive group in the organic coating film in the irradiated second portion, and
allowing a different type of fine particles from the fine particles constituting the firstly formed aligned fine particles to be in contact with the surface of the substrate to form a chemical bond with the organic coating film on the surface of the fine particle.
17. The method for producing aligned fine particles according to claim 13,
wherein the process of forming a bond between the organic coating film on the surface of the fine particle and the organic coating film on the surface of the substrate comprises:
irradiating the organic coating film formed on the surface of the substrate to form a chemically reactive group in the organic coating film in the irradiated portion to form a chemical bond with the organic coating film on the surface of the fine particle, thereby forming aligned fine particles in the energy ray irradiated portion, and
irradiating a second portion that had not been irradiated to form a chemically reactive group in the organic coating film in the second irradiated portion, and allowing a same type of fine particles as the fine particles constituting the firstly formed aligned fine particles to be in contact with the surface of the substrate to form a chemical bond with the organic coating film on the surface of the fine particle, thereby aligning the fine particles in accordance with a two-dimensional shape of the first irradiated portion.
18. The method for producing aligned fine particles according to claim 13,
wherein a disk-shaped substrate is used as the substrate, and the organic coating film is first irradiated along a circumference of a concentric circle sharing a center of the disk, thereby aligning the fine particles along the circumference.
19. The method for producing aligned fine particles according to claim 13,
wherein the process of forming a bond between the organic coating film on the surface of the fine particle and the organic coating film on the surface of the substrate comprises:
irradiating the organic coating film formed on the surface of the substrate, removing the organic coating film in the irradiated portion and forming a chemical bond between the organic coating film in a remaining portion on the surface of the substrate and the organic coating film on the surface of the fine particle, thereby forming a structure comprising fine particles in a portion that is not irradiated, and
forming a structure comprising an organic coating on the substrate of the substrate again, and allowing a different type of fine particles from the organic coating film newly formed on the surface of the substrate and the fine particles constituting the firstly formed fine particle layer to be in contact with the surface of the substrate to form a chemical bond with the organic coating film on the surface of the fine particle.
20. The method for producing aligned fine particles according to claim 13,
wherein the process of forming a bond between the organic coating film on the surface of the fine particle and the organic coating film on the surface of the substrate comprises:
irradiating the organic coating film formed on the surface of the substrate, removing the organic coating film in the irradiated portion and forming a chemical bond between the organic coating film in a remaining portion on the surface of the substrate and the organic coating film on the surface of the fine particle, thereby forming aligned fine particles in a portion that is not irradiated, and
forming a structure comprising an organic coating film on the substrate of the substrate again, and allowing a same type of fine particles as the organic coating film newly formed on the surface of the substrate and the fine particles constituting the firstly formed fine particle layer to be in contact with the surface of the substrate to form a chemical bond with the organic coating film on the surface of the fine particle, thereby aligning the fine particles in accordance with a two-dimensional shape of the irradiated portion.
21. The method for producing aligned fine particles according to claim 13,
wherein the process of forming a bond between the organic coating film on the surface of the fine particle and the organic coating film on the surface of the substrate comprises:
allowing the organic coating film formed on the surface of the substrate to be in contact with the organic coating film formed on the surface of the fine particle to form a chemical bond,
polymerizing the organic coating film formed on the surface of the fine particle to increase an molecular weight of the organic coating film.
22. The method for producing aligned fine particles according to claim 13,
wherein the organic coating film on the surface of the fine particle is bonded to the organic coating film on the surface of the substrate with at least one binding selected from the group consisting of covalent bonding, ion bonding, coordinate binding and intermolecular force binding.
23. The method for producing aligned fine particles according to claim 13,
wherein the organic coating film is a monomolecular film or a polymerized film formed using a monomolecular film as a starting material.
24. The method for producing aligned fine particles according to claim 23,
wherein the monomolecular film is a self-assembling film, and formed of molecules comprising at least one reactive group selected from the group consisting of a thiol group, a chlorosilane group, a coordinate binding group, an isocyanate group and an alkoxysilane group.
25. The method for producing aligned fine particles according to claim 14,
wherein the irradiation is at least one selected from the group consisting of ultraviolet rays, far ultraviolet rays, X-rays, gamma rays, electron rays, and excited plasma.
26. A method for producing a magnetic recording medium on a substrate comprising:
forming an organic coating film on a surface of a fine magnetic particle,
forming an organic coating film on a surface of the substrate,
allowing the organic coating film on the surface of the fine magnetic particle to be in contact with the organic coating film on the surface of the substrate to form a bond between the two organic coating films, and
performing a heat treatment to the fine magnetic particles to increase a coercive force of the fine magnetic particle.
27. The method for producing a magnetic recording medium according to claim 26, wherein before the process of forming the organic coating film on the surface of the substrate, a soft magnetic thin film layer is formed on the substrate by vapor phase rapid quenching.
28. The method for producing a magnetic recording medium according to claim 26, wherein a protective layer further is formed on the surface of the fine magnetic particle layer.
29. The method for producing a magnetic recording medium according to claim 26, wherein particles of the fine magnetic particles have a diameter of 3 nm or more and 50 nm or less.
30. The method for producing a magnetic recording medium according to claim 26, wherein the fine magnetic particles are at least one alloy selected from the group consisting of a FePt alloy and a CoPt alloy.
31. The method for producing a magnetic recording medium according to claim 26, wherein the magnetic field is applied in a direction perpendicular to the substrate plane.
32. The method for producing a magnetic recording medium according to claim 26, wherein the magnetic field is 1 kOe or more.
33. The method for producing a magnetic recording medium according to claim 26, wherein the fine particles have a L10 structure.
34. A method for producing a magnetic recording medium comprising:
the first process of applying fine particles provided with an organic coating on their surfaces on a non-magnetic substrate directly or via an underlying layer, and
the second process of performing a heat treatment to the fine particles in a magnetic field at a temperature of not less than a Curie temperature of the fine particles.
35. The method for producing a magnetic recording medium according to claim 34, wherein the magnetic field is applied from a direction perpendicular to the substrate plane.
36. A magnetoresistive device,
wherein an organic coating film is formed on a surface of a substrate, the organic coating film being bonded to the surface of the substrate,
an organic coating film is formed on a surface of a fine particle, the organic coating film being bonded to the surface of the fine particle,
aligned fine particles in which the fine particles are immobilized and aligned are formed by bonding the organic coating film on the surface of the fine particle to the organic coating film on the substrate, and
at least a pair of electrodes for passing a current through the fine magnetic particles are formed to change an electrical resistance between the electrodes by an external signal magnetic field.
37. A magnetoresistive head comprising a magnetoresistive device and a shield provided outside the magnetoresistive device,
wherein an organic coating film is formed on a surface of a substrate, the organic coating film being bonded to the surface of the substrate,
an organic coating film is formed on a surface of a fine particle, the organic coating film being bonded to the surface of the fine particle,
aligned fine particles in which the fine particles are immobilized and aligned are formed by bonding the organic coating film on the surface of the fine particle to the organic coating film on the surface of the substrate,
at least a pair of electrodes for passing a current through the fine magnetic particles are formed to change an electrical resistance between the electrodes by an external signal magnetic field, and
the shield is provided for preventing a magnetic field other than the signal magnetic field from entering the magnetoresistive device.
38. A magnetoresistive head comprising a magnetoresistive device and a yoke provided outside the magnetoresistive device,
wherein an organic coating film is formed on a surface of a substrate, the organic coating film being bonded to the surface of the substrate,
an organic coating film is formed on a surface of a fine particle, the organic coating film being bonded to the surface of the fine particle,
aligned fine particles in which the fine particles are immobilized and aligned are formed by bonding the organic coating film on the surface of the fine particle to the organic coating film on the surface of the substrate,
at least a pair of electrodes for passing a current through the fine magnetic particles are formed to change an electrical resistance between the electrodes by an external signal magnetic field, and
the yoke is provided for guiding the signal magnetic field to the magnetoresistive device.
39. A semiconductor device comprising a barrier layer serving as a tunnel barrier layer provided on a semiconductor substrate,
wherein an organic coating film is formed on a surface of the barrier layer, the organic coating film being bonded to the barrier layer,
an organic coating film is formed on surfaces of fine particles, the organic coating film being bonded to the surfaces of the fine particles,
aligned fine particles in which the fine particles are immobilized and aligned are formed by bonding the organic coating film on the surfaces of the fine particles to the organic coating film on the surface of the barrier layer,
the semiconductor device comprising an electrically insulating layer provided on the barrier layer and the fine particle layer.
40. A semiconductor memory device having an insulating gate semiconductor (MIS) type transistor structure comprising a barrier layer serving as a tunnel barrier layer between a gate insulating film of the MIS type transistor structure and a semiconductor substrate, the barrier layer provided on the semiconductor substrate,
wherein an organic coating film bonded to a surface of the substrate is formed,
an organic coating film is formed on surfaces of fine particles, the organic coating film being bonded to the surfaces of the fine particles,
and aligned fine particles in which the fine particles are immobilized and aligned are formed on the surface of the barrier layer by bonding the organic coating film on the surface of the surfaces of the fine particles to the organic coating film on the surface of the substrate.
41. A method for controlling a crystal orientation of fine particles, wherein in a process for ordering fine particles comprising a random alloy, a crystal orientation is controlled by applying a magnetic field at a temperature of a Curie temperature or more.
42. The method for controlling a crystal orientation of fine particles according to claim 41, wherein the fine particles have a diameter of 3 nm or more and 50 nm or less.
43. The method for controlling a crystal orientation of fine particles according to claim 41, wherein the magnetic field is 1 kOe or more.
44. The method for controlling a crystal orientation of fine particles according to claim 41, wherein the fine particles have a L10 structure.
45. The method for controlling a crystal orientation of fine particles according to claim 41, wherein the fine particles are made of FePT or a CoPt alloy.
46. A method for aligning fine particles, wherein the fine particles provided with an organic coating film on their surfaces are aligned in a concave portion in a concave and convex pattern formed on a surface of a substrate.
47. The method for aligning fine particles according to claim 46, wherein the fine particles provided with the organic coating film have a diameter of 1 nm or more and 50 nm or less.
48. The method for aligning fine particles according to claim 46, wherein the concave and convex pattern has a cycle of a length of not less than five times and not more than 30 times the diameter of the fine particles.
49. A method for producing a magnetic recording medium on a substrate comprising:
forming a soft magnetic thin film layer on the substrate by vapor phase rapid quenching,
forming an organic coating film on a surface of a fine magnetic particle,
forming an organic coating film on a surface of the substrate,
allowing the organic coating film on the surface of the fine magnetic particle to be in contact with the organic coating film on the surface of the substrate to form a bond between the two organic coating films.
50. The method for producing a magnetic recording medium according to claim 49, wherein a protective layer further is formed on the surface of the fine magnetic particle layer.
51. The method for producing a magnetic recording medium according to claim 49, wherein particles of the fine magnetic particles have a diameter of 3 nm or more and 50 nm or less.
52. The method for producing a magnetic recording medium according to claim 49, wherein the fine magnetic particles are at least one alloy selected from the group consisting of a FePt alloy and a CoPt alloy.
53. The method for producing a magnetic recording medium according to claim 49, wherein the magnetic field is applied in a direction perpendicular to the substrate plane.
54. The method for producing a magnetic recording medium according to claim 49, wherein the magnetic field is 1 kOe or more.
55. The method for producing a magnetic recording medium according to claim 49, wherein the fine particles have a L10 structure.

The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.

1. An immune adjuvant composition comprising
(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria; and
(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,
wherein the immunostimulatory oligonucleotide is not a part of a DNA vaccine vector, and
wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.
2. The immune adjuvant composition as claimed in claim 1, wherein the saponin comprises a substantially pure saponin.
3. The immune adjuvant composition as claimed in claim 2, wherein the substantially pure saponin is QS-7, QS-17, QS-18, or QS-21.
4. The immune adjuvant composition as claimed in claim 3, wherein the substantially pure saponin is QS-21.
5. The immune adjuvant composition as claimed in claim 1 or 4, wherein the immunostimulatory oligonucleotide comprises more than one unmethylated CpG dinucleotide.
6. The immune adjuvant composition as claimed in claim 1 or 4, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.
7. The immune adjuvant composition as claimed in claim 1 or 4, wherein the immunostimulatory oligonucleotide comprises at least one phosphorothioate modified nucleotide.
8. The immune adjuvant composition as claimed in claim 1, wherein the immunostimulatory oligonucleotide comprises a CpG motif having the formula 5\u2032X1CGX23\u2032, wherein X1 is adenine, guanine, or thymine, and X2 is cytosine, thymine, or adenine.
9. The immune adjuvant composition as claimed in claim 1 or 4, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1).
10. An immune adjuvant composition comprising
(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria; and
(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,
wherein the saponin is substantially pure, and the saponin is QS-7, QS-17 or QS-18, and
wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.
11. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 10 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.
12. An immune adjuvant composition comprising
(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria; and
(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,
wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester, and
wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.
13. The immune adjuvant composition as claimed in claim 12, wherein the immunostimulatory oligonucleotide comprises at least one phosphorothioate modified nucleotide.
14. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 12 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.
15. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 13 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.
16. An immune adjuvant composition comprising
(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria; and
(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,
wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTFCGCCAT (SEQ ID NO:1), and,
wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.
17. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 16 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.
18. An immune adjuvant composition comprising
(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria; and
(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,
wherein the immunostimulatory oligonucleotide comprises TCCATGACGTTCCTGACGTT (SEQ ID NO:2), and
wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.
19. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 18 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.
20. An immune adjuvant composition comprising
(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria; and
(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide, wherein the immunostimulatory oligonucleotide is 4\u201340 bases in length, and
wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.
21. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 20 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.
22. An immune adjuvant composition comprising
(a) a saponin possessing immune adjuvant activity, wherein the saponin (i) is derived from Quillaja saponaria and (ii) is a chemically modified saponin; and
(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide,
wherein the saponin and immunostimulatory oligonucleotide have a synergistic adjuvant effect.
23. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 22 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.
24. The composition of claim 1, wherein the saponin is a chemically modified saponin.
25. The immune adjuvant composition as claimed in claim 1 or 4, wherein the immunostimulatory oligonucleotide comprises TCCATGACGTTCCTGACGTT (SEQ ID NO:2).
26. A method for inducing an immune response in an individual to an antigen comprising (1) administering an amount of the immune adjuvant composition as claimed in claim 1 to the individual; and (2) administering a nucleic acid molecule comprising a nucleotide sequence encoding the antigen to the individual, wherein (1) and (2) induce an immune response in the individual to the antigen.
27. The method as claimed in any of claims 14, 15, 17, 19, 21, 23, or 26, wherein the saponin comprises is a substantially pure saponin.
28. The method as claimed in claim 27, wherein the substantially pure saponin is QS-7, QS-17, QS-18, or QS-21.
29. The method as claimed in claim 28, wherein the substantially pure saponin is QS-21.
30. The method as claimed in any of claims 11, 14, 15, 17, 19, 21, 23, or 26, wherein the immunostimulatory oligonucleotide comprises more than one unmethylated CpG dinucleotide.
31. The method as claimed in any of claims 11, 17, 19, 21, 23, or 26, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.
32. The method as claimed in any of claims 11, 17, 19, 21, 23, or 26, wherein the immunostimulatory oligonucleotide comprises at least one phosphorothioate modified nucleotide.
33. The method as claimed in any of claims 11, 14, 15, 17, 19, 21, 23, or 26, wherein the immunostimulatory oligonucleotide comprises a CpG motif having the formula 5\u2032X1CGX23\u2032, wherein X1 is adenine, guanine, or thymine, and X2 is cytosine, thymine, or adenine.
34. The method as claimed in any of claims 11, 14, 15, 21, 23, or 26, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).
35. The method as claimed in any of claims 11, 14, 15, 21, 19, 21, 23, or 26, wherein the individual is an animal.
36. The method as claimed in claim 35, wherein the animal is a mammal.
37. The method as claimed in any of claims 11, 14, 15, 21, 19, 21, 23, or 26, wherein the individual is a human.
38. A vaccine composition comprising
(a) a saponin possessing immune adjuvant activity, wherein the saponin is derived from Quillaja saponaria;
(b) an immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide; and
(c) a nucleic acid molecule comprising a nucleotide sequence encoding an antigen, wherein the nucleotide sequence is operatively linked to a promoter,
wherein the immunostimulatory oligonucleotide is not a part of the nucleic acid molecule comprising the nucleotide sequence encoding the antigen.
39. The vaccine composition as claimed in claim 38, wherein the saponin is a substantially pure saponin.
40. The vaccine composition as claimed in claim 39, wherein the substantially pure saponin is QS-7, QS-17, QS-18, or QS-21.
41. The vaccine composition as claimed in claim 40, wherein the substantially pure saponin is QS-21.
42. The vaccine composition as claimed in claim 38, wherein the immunostimulatory oligonucleotide comprises more than one unmethylated CpG dinucleotide.
43. The vaccine composition as claimed in claim 38, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.
44. The vaccine composition as claimed in claim 38, wherein the immunostimulatory oligonucleotide comprises at least one phosphorothioate modified nucleotide.
45. The vaccine composition as claimed in claim 38, wherein the immunostimulatory oligonucleotide comprises a CpG motif having the formula 5\u2032X1CGX23\u2032, wherein X1 is adenine, guanine, or thymine, and X2 is cytosine, thymine, or adenine.
46. The vaccine composition as claimed in claim 38 or 41, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).
47. The method of any of claims 11, 17, 19, 23, or 26, wherein the nucleic acid molecule encoding the antigen is administered to the individual concurrently with the immune adjuvant composition.
48. The method of any of claims 14, 15, or 21, wherein the nucleic acid molecule encoding the antigen is administered to the individual concurrently with the immune adjuvant composition.
49. The method as claimed in any of claims 14, 15, 21, 23, and 26, wherein the saponin is substantially pure, wherein the saponin is QS-21, and wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).
50. The immune adjuvant composition as claimed in claim 12 or 20, wherein the saponin is chemically modified.
51. The immune adjuvant composition as claimed in claim 12, 20 or 22, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).
52. The immune adjuvant composition as claimed in claim 12 or 22, wherein the saponin is substantially pure.
53. The immune adjuvant composition as claimed in claim 52, wherein the saponin is QS-21.
54. The immune adjuvant composition as claimed in claim 53, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).
55. The immune adjuvant composition as claimed in claim 20, wherein the saponin is substantially pure.
56. The immune adjuvant composition as claimed in claim 55, wherein the saponin is QS-21.
57. The immune adjuvant composition as claimed in claim 20 or 56, wherein the immunostimulatory oligonucleotide comprises at least one chemical group selected from the group consisting of phosphorothioate, alkylphosphonate, phophorodithioate, alkylphosphorothioate, phosphoramidate, 2-O-methyl, carbamate, acetamidate, carboxymethyl ester, carbonate, and phosphate triester.
58. The immune adjuvant composition as claimed in claim 56, wherein the immunostimulatory oligonucleotide comprises TCTCCCAGCGTGCGCCAT (SEQ ID NO:1) or TCCATGACGTTCCTGACGTT (SEQ ID NO:2).
59. The immune adjuvant composition as claimed in claim 16 or 18, wherein the saponin is substantially pure.
60. The immune adjuvant composition as claimed in claim 59, wherein the saponin is QS-21.