1. A synthetic double-stranded DNA for forming a human TOPII (hTOPII)-DNA binary complex comprising:
a first DNA strand corresponding to nucleotide positions 3 to 20 of the sequence of 5\u2032-NNNCCGAGCNNNNGCTCGGNNN-3\u2032 (SEQ ID NO: 1), wherein N is any one of adenine, thymine, cytosine or guanine; and
a second DNA strand that is complementary to the first DNA strand.
2. The synthetic double-stranded DNA of claim 1, wherein the first DNA strand comprises a 5\u2032-C\u2193NNNNG-3\u2032 cleavage site, and the arrow indicates the cleavage position where the strand DNA is cut by hTOPII.
3. The synthetic double-stranded DNA of claim 1, wherein the first DNA strand has a sequence from 5\u2032 to 3\u2032, GCCGAGCTGCAGCTCGGC (SEQ ID NO: 2).
4. The synthetic double-stranded DNA of claim 3, wherein the first DNA strand comprises a 5\u2032-C\u2193TGCAG-3\u2032 cleavage site of the SEQ ID NO:2, and the arrow indicates the cleavage position where the strand DNA is cut by hTOPII.
5. The synthetic double-stranded DNA of claim 1, wherein the first DNA strand has a sequence from 5\u2032 to 3\u2032, AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3).
6. The synthetic double-stranded DNA of claim 5, wherein the first DNA strand comprises a 5\u2032-C\u2193TGCAG-3\u2032 cleavage site of the SEQ ID NO:3, and the arrow indicates the cleavage position where the strand DNA is cut by hTOPII.
7. The synthetic double-stranded DNA of claim 1, wherein the hTOPII comprises \u03b1 form and \u03b2 form.
8. A crystal of an hTOPIIcore-DNA binary complex comprising:
an hTOPII portion comprising an hTOPII core domain (hTOPIIcore); and
a synthetic double-stranded DNA of claim 1, which is in complex with the hTOPII portion.
9. The crystal of claim 8, wherein:
the hTOPII is hTOPII\u03b1; and
the first DNA strand has a sequence from 5\u2032 to 3\u2032, AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3).
10. The crystal of claim 8, wherein:
the hTOPII is hTOPII\u03b2; and
the first DNA strand has a sequence from 5\u2032 to 3\u2032, AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3).
11. The crystal of claim 10, wherein the crystal has a crystal lattice in a P21 space group and unit cell dimensions of a=80.0\xb12 \u212b, b=176.4\xb13 \u212b, c=94.2\xb12 \u212b, and \u03b2=112.1\xb13 degree.
12. A method for preparing a crystal of an hTOPIIcore-DNA binary complex comprising the steps of:
(a) forming an hTOPIIcore-DNA-ligand ternary complex by mixing an hTOPII portion comprising an hTOPII core domain, a synthetic double-stranded DNA of claim 1, and a ligand;
(b) crystallizing the hTOPIIcore-DNA-ligand ternary complex by mixing the hTOPIIcore-DNA-ligand ternary complex with a first solution; and
(c) soaking out the ligand from the crystallized hTOPIIcore-DNA-ligand ternary complex by placing the crystallized hTOPIIcore-DNA-ligand ternary complex in a second solution thereby obtaining the crystal of the hTOPIIcore-DNA binary complex.
13. The method of claim 12, wherein:
the hTOPII is hTOPII\u03b1;
the first DNA strand has a sequence from 5\u2032 to 3\u2032, AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3); and
the ligand is mitoxantrone.
14. The method of claim 13, wherein in the step (a), the synthetic double-stranded DNA of claim 1 is mixed with the hTOPII\u03b1portion in a molar ratio of about 1:1 to 1.5:1.
15. The method of claim 13, wherein the first solution in the step (b) comprises 100 mM magnesium acetate, 50 mM 2-(N-morpholino)ethanesulfonic acid (pH 5.2-6.0), and 20-27 wt % 2-methyl-1,6-hexanediol (MPD).
16. The method of claim 13, wherein the second solution in the step (c) comprises 100 mM magnesium acetate, 50 mM 2-(N-morpholino)ethanesulfonic acid (pH 5.2-6.0), and 30-40 wt % 2-methyl-1,6-hexanediol (MPD).
17. The method of claim 12, wherein:
the hTOPII is hTOPII\u03b2;
the first DNA strand has a sequence from 5\u2032 to 3\u2032, AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3); and
the ligand is etoposide.
18. The method of claim 17, wherein in the step (a), the synthetic double-stranded DNA of claim 1 is mixed with the hTOPII\u03b2 portion in a molar ratio of about 1:1 to 1.5:1.
19. The method of claim 17, wherein the first solution in the step (b) comprises 100 mM magnesium acetate, 50 mM 2-(N-morpholino)ethanesulfonic acid (pH 5.6-6.5), and 18-22 wt % 2-methyl-1,6-hexanediol (MPD).
20. The method of claim 17, wherein the second solution in the step (c) comprises 100 mM magnesium acetate, 50 mM 2-(N-morpholino)ethanesulfonic acid (pH 5.6-6.5), and 22-40 wt % 2-methyl-1,6-hexanediol (MPD).
21. A crystal of an hTOPIIcore-DNA-ligand ternary complex comprising:
an hTOPII portion comprising an hTOPII core domain; and
a synthetic double-stranded DNA of claim 1 and a ligand, which are in complex with the hTOPII portion.
22. The crystal of claim 21, wherein the
hTOPII is hTOPII\u03b1; and
the first DNA strand has a sequence from 5\u2032 to 3\u2032, AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3).
23. The crystal of claim 22, wherein the ligand is mitoxantrone.
24. The crystal of claim 23, wherein the crystal has a crystal lattice in a P21221 space group and unit cell dimensions of a=105.4\xb12 \u212b, b=126.2\xb13 \u212b, and c=198.0\xb12 \u212b.
25. The crystal of claim 21, wherein the
hTOPII is hTOPII\u03b2; and
the first DNA strand has a sequence from 5\u2032 to 3\u2032, AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3).
26. The crystal of claim 25, wherein the ligand is etoposide.
27. The crystal of claim 26, wherein the crystal has a crystal lattice in a P21 space group and unit cell dimensions of a=80.2\xb12 \u212b, b=176.8\xb13 \u212b, c=94.0\xb12 \u212b, and p=111.6\xb13 degree.
28. The crystal of claim 25, wherein the ligand is mitoxantrone.
29. The crystal of claim 28, wherein the crystal has a crystal lattice in a P21 space group and unit cell dimensions of a=80.5\xb12 \u212b, b=176.6\xb13 \u212b, c=93.8\xb12 \u212b, and \u03b2=111.5\xb13 degree.
30. The crystal of claim 25, wherein the ligand is doxorubicin.
31. The crystal of claim 30, wherein the crystal has a crystal lattice in a P21 space group and unit cell dimensions of a=80.3\xb12 \u212b, b=176.6\xb13 \u212b, c=94.0\xb13 \u212b, and \u03b2=111.5\xb13 degree.
32. The crystal of claim 25, wherein the ligand is amsacrine.
33. The crystal of claim 32, wherein the crystal has a crystal lattice in a P21 space group and unit cell dimensions of a=80.2\xb12 \u212b, b=176.8\xb13 \u212b, c=94.0\xb13 \u212b, and \u03b2=111.6\xb13 degree.
34. The crystal of claim 25, wherein the ligand is ametantrone.
35. The crystal of claim 34, wherein the crystal has a crystal lattice in a P21 space group and unit cell dimensions of a=80.2\xb12 \u212b, b=176.8\xb13 \u212b, c=94.0\xb13 \u212b, and 3=111.6\xb13 degree.
36. A high throughput screening platform for identifying a ligand exhibiting inhibitory effect toward hTOPII comprising steps of:
forming an hTOPIIcore-DNA-ligand ternary complex by soaking a ligand into the crystal of hTOPIIcore-DNA binary complex from claim 21;
obtaining an X-ray crystal diffraction pattern of the hTOPIIcore-DNA-ligand ternary complex; and
using the X-ray crystal diffraction pattern to analyze the structure of hTOPIIcore-DNA-ligand ternary complex, and identify ligand-interacting residues on hTOPII,
wherein the ligand comprises a hTOPII-targeting agent.
37. The high throughput screening platform of claim 36, wherein the hTOPII is hTOPII\u03b1.
38. The high throughput screening platform of claim 37, wherein the first DNA strand has a sequence from 5\u2032 to 3\u2032, GCCGAGCTGCAGCTCGGC (SEQ ID NO: 2).
39. The high throughput screening platform of claim 37, wherein the first DNA strand has a sequence from 5\u2032 to 3\u2032, AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3).
40. The high throughput screening platform of claim 36, wherein the hTOPII is hTOPII\u03b2.
41. The high throughput screening platform of claim 40, wherein the first DNA strand has a sequence from 5\u2032 to 3\u2032, GCCGAGCTGCAGCTCGGC (SEQ ID NO: 2).
42. The high throughput screening platform of claim 40, wherein the first DNA strand has a sequence from 5\u2032 to 3\u2032, AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3).
43. An hTOPII-targeting agent comprising:
a core domain of polycyclic ring system inserting into a DNA cleavage site, wherein the polycyclic ring system has a number of cyclic rings are 2, 3, or 4, and the individual ring is aromatic or non-aromatic.
44. The hTOPII-targeting agent of claim 43, further comprising at least one of a first branching moiety for fitting between a hTOPII\u03b1 and a DNA minor groove binding pocket.
45. The hTOPII-targeting agent of claim 44, wherein the DNA minor groove binding pocket comprises amino acids residues including Pro439, Gly462, Asp463, Leu486, Arg487, Gly488, Asn504, Ala505, Glu506, or combination thereof.
46. The hTOPII-targeting agent of claim 43, further comprising at least one of a second branching moiety fitting between hTOP II\u03b1 and a DNA major groove binding pocket.
47. The hTOPII-targeting agent of claim 46, wherein the DNA major groove binding pocket comprises amino acids Met762 or Met766.
48. The hTOPII-targeting agent of claim 43, further comprising at least one of a first branching moiety for fitting between a hTOPII\u03b2 and a DNA minor groove binding pocket.
49. The hTOPII-targeting agent of claim 48, wherein the DNA minor groove binding pocket comprises amino acids residues including Pro455, Gly478, Asp479, Leu502, Arg503, Gly504, Asn520, Ala521, Glu522, or combination thereof.
50. The hTOPII-targeting agent of claim 43, further comprising at least one of a second branching moiety for protruding toward DNA major groove and fitting between hTOPII\u03b2 and a DNA major groove binding pocket.
51. The hTOPII-targeting agent of claim 50, wherein the DNA major groove binding pocket comprises amino acids Gln778, and Met782.
The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.
1. A method of handling syndication feed information comprising:
subscribing to a syndication feed;
binding the syndication feed to a calendar data item; and
presenting feed data in a calendar application proximate to a calendar item associated with the calendar data item, wherein the feed data is automatically obtained from the syndication feed.
2. The method of claim 1, further comprising:
identifing a syndication reader integrated to a calendar application; and
the syndication reader automatically acquiring updates from a feed source in accordance with the feed subscription of the subscribing step, wherein the presented feed data comprises the acquired updates.
3. The method of claim 1, further comprising:
subscribing to a calendar data exchange formatted calendar publication; and
presenting calendar data from the calendar publication in the calendar application.
4. The method of claim 3, wherein the syndication feed is integrated into the calendar publication, and wherein calendar publication comprises the calendar data item.
5. The method of claim 4, wherein the calendar publication is written in an iCalendar (iCal) based format, and wherein the syndication feed is at least one of a Really Simple Syndication (RSS) feed and an ATOM feed.
6. The method of claim 1, wherein the syndication feed is bound to a calendar application entry, wherein the syndication feed once bound automatically updates the calendar entry without user intervention whenever the syndication feed updates feed data in accordance with a subscription of the subscribing step.
7. The method of claim 1, wherein the calendar data item is associated with a calendar application entry, said binding step further comprising:
binding a user selected syndication feed to the calendar application entry using a calendar application tool.
8. The method of claim 1, further comprising:
detecting a calendar event resulting from a user interaction with the calendar application, wherein said calendar data item is associated with a datetime, and wherein the user interaction also associated with the calendar datetime; and
automatically presenting the feed data responsive to the detected calendar event.
9. The method of claim 1, further comprising:
detecting a feed update event for the syndication feed; and
automatically updating the feed data that is presented in the calendar application responsive to the feed update event
10. The method of claim 1, wherein the syndication feed is at least one of a Really Simple Syndication (RSS) feed and an ATOM feed, and wherein the calendar data item is written in an iCalendar (iCal) based format.
11. The method of claim 1, wherein said steps of claim 1 are steps performed automatically by at least one machine in accordance with at least one computer program having a plurality of code sections that are executable by the at least one machine, said at least one computer program being stored in a machine readable medium.
12. A calendar application stored in a machine readable medium comprising:
a feed reader configured to acquire syndication feed data from a feed source; and
a plurality of calendar entries managed by the calendar application, wherein at least one of the calendar entries is configured to be programmatically linked to the feed source which provides syndication feed data in accordance with a subscription so that feed data from the subscription is automatically placed in the calendar entry without user intervention whenever syndication feed updates are obtained by the feed reader.
13. The calendar application of claim 12, further comprising:
a calendar application interface tool for binding user specified syndication feeds to at least one of the calendar entries.
14. The calendar application of claim 12, further comprising:
a calendar data exchange engine configured to support an acquisition and publication of calendar data exchange formatted data, wherein at least one of the calendar entries comprises data processed by the calendar data exchange engine from a calendar data exchange formatted file.
15. The calendar application of claim 14, wherein the subscription from which the syndication feed data is acquired is specified in the calendar data exchange formatted file.
16. The calendar application of claim 15, wherein the calendar data exchange formatted file is a calendar publication obtained from a calendar source remotely located from a machine upon which the calendar application is stored and executed.
17. The calendar application of claim 14, wherein the syndication feed is at least one of a Really Simple Syndication (RSS) feed and an ATOM feed, and wherein the calendar data exchange format is an iCalendar (iCal) compliant format.
18. A software interface comprising:
a plurality of calendar entry visual elements, each associated with a datetime within which editable information is able to be presented within the software interface;
a calendar data exchange import tool configured to automatically obtain calendar data from a calendar publication formatted in a calendar data exchange format, wherein calendar data obtained using the calendar data exchange import tool is automatically presented in one of the suitable calendar entry visual elements, wherein suitable visual elements for the calendar data are based upon matching datetime values of the calendar data with datetime values associated with the visual elements; and
a syndication feed establishment tool configured to bind a user specified syndication feed to one of the at least one calendar entry visual element, wherein after being bound, feed data obtained from the specified syndication feed is automatically placed in calendar entries to which the feed is bound without user intervention, wherein suitable visual elements for the calendar data.
19. The software interface of claim 18, wherein at least one syndication feed that is bound to calendar entry visual elements is specified by calendar data obtained using the calendar data exchange import tool.
20. The software interface of claim 18, wherein the software interface is an interface of a calendar application, and wherein the syndication feed is at least one of a Really Simple Syndication (RSS) feed and an ATOM feed, and wherein the calendar data exchange format is an iCalendar (iCal) compliant format.