1. An image decoding device comprising:
an error detecting unit operable to detect a decoding error in each unit area in one frame of an image;
an error compensating area determining unit operable to determine an error compensating area for which error compensation for the decoding error should be performed, and
an error compensating unit operable to perform error compensation for the error compensating area,
wherein said error compensating area determining unit determines the unit area where the decoding error occurs and a predetermined area adjacent to the unit area where the decoding error occurs as the error compensating area.
2. The image decoding device as defined in claim 1, wherein the predetermined area includes a target pixel of in-loop filtering using a pixel included in the unit area where the decoding error occurs.
3. The image decoding device as defined in claim 1, wherein the unit area is constituted in a unit of at least one of a slice and a macro block defined by at least one of the H.263 standard and the H.264 standard.
4. The image decoding device as defined in claim 3, wherein the unit area is constituted in a unit of at least one of the slice and the macro block in accordance with receiving condition.
5. The image decoding device as defined in claim 1, wherein the decoding error includes at least one of an arithmetic decoding error and a variable-length decoding error.
6. The image decoding device as defined in claim 2, further comprising a judging unit operable to judge a in-loop filtering condition is in either an executed condition or a non-executed condition,
wherein when a judging result of said judging unit indicates that the in-loop filtering is in the executed condition, said error compensating area determining unit determines the area including the target pixel of the in-loop filtering using the pixel included in the unit area where the decoding error occurs as the predetermined area.
7. The image decoding device as defined in claim 2, wherein said error compensating area determining unit changes the predetermined area when a target area of the in-loop filtering changes.
8. The image decoding device as defined in claim 1, wherein said error compensating unit replaces a value of a pixel included in the error compensating area of a picture frame with a value of a corresponding pixel included in a frame prior to the one frame of the image.
9. The image decoding device as defined in claim 1, wherein said error compensating unit replaces a value of a pixel included in the error compensating area with a value of a pixel neighboring the error compensating area.
10. The image decoding device as defined in claim 1, wherein said error compensating unit replaces a value of a pixel included in the error compensating area with a fixed value.
11. The image decoding device as defined in claim 1, wherein said error compensating unit replace a value of a pixel included in the predetermined area of the error compensating area with a value of a corresponding pixel prior for which the in-loop filtering has not performed, the corresponding pixel being included in the predetermined area.
12. An integrated semiconductor circuit comprising:
an error detecting unit operable to detect a decoding error in each unit area in one frame of an image;
an error compensating area determining unit operable to determine an error compensating area for which error compensation for the decoding error should be performed, and
an error compensating unit operable to perform error compensation for the error compensating area,
wherein said error compensating area determining unit determines the unit area where the decoding error occurs and predetermined area adjacent to the unit area where the decoding error occurs as the error compensating area.
13. The integrated semiconductor circuit as defined in claim 12, wherein the predetermined area includes a target pixel of in-loop filtering using a pixel included in the unit area where the decoding error occurs.
14. The integrated semiconductor circuit as defined in claim 12, wherein said error compensating unit replaces a value of a pixel included in the error compensating area with at least one of: a value of a corresponding pixel included in a frame prior to the one of the image; a value of a pixel neighboring the error compensating area; and a fixed value.
15. An image decoding method comprising;
detecting a decoding error in each unit area in one frame of an image;
determining an error compensating area for which error compensation for the decoding error should be performed; and
performing error compensation for the error compensating area,
wherein said performing includes determining the unit area where the decoding error occurs and a predetermined area adjacent to the unit area where the decoding error occurs as the error compensating area.
16. The image decoding method as defined in claim 15, wherein the predetermined area includes a target pixel of in-loop filtering using a pixel included in the unit area where the decoding error occurs.
17. The image decoding method as defined in claim 15, wherein said performing includes replacing a value of a pixel included in the error compensating area with at least one of: a value of a corresponding pixel included in a frame prior to the one frame of the image; a value of a pixel neighboring the error compensating area; and a fixed value.
The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.
What is claimed is:
1. A fluorescence-based probe system for analyzing a target nucleic acid consisting essentially of
a single-labeled polynucleotide comprising a sequence generally complementary to a locus of the nucleic acid and a fluorescent label attached thereto,
whereby upon hybridization of the single-labeled polynucleotide to the locus of the nucleic acid the fluorescent label is positioned near a residue of the target nucleic acid with a resultant increase in fluorescent intensity of the fluorescent label.
2. The probe system of claim 1 wherein the fluorescent label is attached to a terminal nucleotide.
3. The probe system of claim 2 wherein the terminal nucleotide is a base analog.
4. The probe system of claim 3 wherein the base analog is selected from the group consisting of 5-nitroindole, 4-nitroindole, 6-nitroindole, 3-nitropyrrole, 5-iodo-cytidine, inosine, and nubluarine deoxynucleosides.
5. The probe system of claim 2 wherein the terminal nucleotide comprises a G residue.
6. The probe system of claim 5 wherein the target nucleic acid has a C residue in a complementary position.
7. A probe for analyzing a target nucleic acid comprising
a fluorescent detecting entity consisting essentially of a single-labeled oligonucleotide having a sequence generally complementary to a locus of the target nucleic acid and a fluorescent label linked to an internal residue of the oligonucleotide, and
wherein oligonucleotide sequence of the probe being selected so that upon hybridization of the probe to the locus of the target nucleic acid the magnitude of fluorescent emission from the fluorescent label is altered by hybridization of the probe to the target nucleic acid.
8. The probe of claim 7 wherein hybridization of the probe to the target nucleic acid places a G residue in positions 1, 0, or 1 relative to the position of the internal residue, and the fluorescent label is linked to the internal residue by a linker sufficiently flexible to allow quenching by the G residue.
9. The probe of claim 7 wherein the internal residue is a G residue, and hybridization of the oligonucleotide to the target nucleic acid results in an increase in fluorescent emission.
10. An oligonucleotide probe for detecting the presence of a target nucleic acid from the genus Salmonella said probe comprising a nucleotide sequence selected from the group consisting of 5CCAAAAGGCAGCGTCTGTTCC (SEQ ID NO:3), 5CCAAAAGGCAGCGTCTGTTC (SEQ ID NO:4), 5CAAAAGGCAGCGTCTGTTCC (SEQ ID NO:5), 5CCAAAAGGCAGCGTCTGTT (SEQ ID NO:6), 5CAAAAGGCAGCGTCTGTT SEQ ID NO:7), 5 AAAAGGCAGCGTCTGTTC (SEQ ID NO:8), 5AAAAGGCAGCGTCTGTTCC (SEQ ID NO:9), and 5AAAAGGCAGCGTCTGTT (SEQ ID NO:10).
11. The oligonucleotide probe of claim 10 wherein the target sequence is selected from the group consisting of
26
5AGGAACAGACGCTGCCTTTTGGC (SEQ ID NO:11)
5AGGAACAGACGCTACCTTTTGGC (SEQ ID NO:12)
5AGGAACAAACGCTACCTTTTGGC (SEQ ID NO:13).
12. The oligonucleotide probe of claim 10 wherein a fluorescent label is linked to an end of the nucleotide sequence, at least one guanine residue is present in the target sequence at positions 0, 1, or 2 relative to the position of the fluorescent label and hybridization of the oligonucleotide probe to the target sequence alters fluorescent emission from the fluorescent label.
13. The oligonucleotide probe of claim 12 wherein said fluorescent label is selected from the group consisting of fluorescein, fluorescein derivatives, cyanine conjugates, and fluorescein-cyanine conjugates.
14. A method for determining the presence of a target nucleic acid sequence in a biological sample comprising:
combining a first single-labeled oligonucleotide probe with the sample, said first probe having an oligonucleotide sequence generally complementary to a locus of the target nucleic acid sequence and a fluorescent label linked to an end of the oligonucleotide sequence, the fluorescent label exhibiting a hybridization-dependent fluorescent emission, wherein hybridization of the first probe to the target nucleic acid sequence allows interaction of the fluorescent label with a guanine residue located on the target nucleic acid, thereby decreasing the magnitude of fluorescent emission from the label,
illuminating the biological sample, and
monitoring the hybridization-dependent fluorescent emission.
15. The method of claim 14 further comprising the steps of
amplifying the target nucleic acid sequence in the presence of the first probe and monitoring the hybridization-dependent fluorescent emission as a function of amplification cycle.
16. The method of claim 14 wherein the guanine residue is present in the target nucleic acid sequence at positions 0, 1, or 2.
17. The method of claim 16 wherein the G residue is located at position 1.
18. The method of claim 16 further comprising the step of determining a maximum dFdT as the first probe dissociates from the target nucleic acid sequence.
19. The method of claim 14 further comprising the steps of:
combining the mixture with a pair of oligonucleotide primers, wherein the oligonucleotide primers are configured for amplifying the locus of the target nucleic acid sequence; and
adding a polymerase and amplifying the selected segment of the nucleic acid sequence.
20. The method of claim 19 wherein the selected segment of the target nucleic acid sequence is amplified by polymerase chain reaction.
21. The method of claim 14 further comprising
providing a second oligonucleotide probe having an oligonucleotide sequence generally complementary to a second locus of the target nucleic acid sequence and having a second fluorescent label linked to an end of the second oligonucleotide sequence, the second fluorescent label exhibiting a hybridization-dependent fluorescent emission at a wavelength different from the fluorescent emission of the first probe, wherein hybridization of the second oligonucleotide probe to the second locus allows interaction of the second fluorescent label with a second guanine residue located on the locus, thereby decreasing the magnitude of fluorescent emission from the second label, and
monitoring the hybridization-dependent fluorescent emission of the second probe.
22. The method of claim 19 wherein the hybridization-dependent fluorescent emission is monitored as a function of sample temperature.
23. The method of claim 19 wherein the hybridization-dependent fluorescent emission is monitored as a function of cycle number.
24. The method of claim 14 wherein the pH is 7.7, the Tris concentration is about 200 mM, and the concentration of monovalent cations is about 50-100 mM.
25. A method for determining the presence of a target nucleic acid sequence in a biological sample comprising:
combining a single-labeled oligonucleotide probe with the sample, said probe having an oligonucleotide sequence generally complementary to a locus of the target nucleic acid sequence and a fluorescent label linked to a G residue of the oligonucleotide sequence, the fluorescent label exhibiting a hybridization-dependent fluorescent emission, wherein hybridization of the oligonucleotide probe to the target nucleic acid sequence alters interaction of the fluorescent label with the G residue, thereby increasing the fluorescent emission from the label,
illuminating the biological sample, and
monitoring the hybridization-dependent fluorescent emission.
26. The method of claim 26 wherein the G residue comprises a terminal residue of the oligonucleotide sequence.
27. The method of claim 26 wherein the locus of the target nucleic acid sequence has a C residue in the complementary location to the G residue.
28. The method of claim 27 wherein hybridization of the oligonucleotide sequence to the target nucleic acid creates an overhang adjacent to the C residue of the target nucleic acid.
29. The method of claim 28 wherein residues other than G are located at positions 1, 1, and 2.
30. The method of claim 26 wherein guanine residues are absent from positions 1 and 1 on the target nucleic acid sequence.
31. The method of claim 25 wherein the hybridization-dependent fluorescent emission is measured as a function of sample temperature.
32. The method of claim 25 wherein the probe and sample are combined in a solution having pH of >8.0.
33. The method of claim 32 wherein the solution has a Tris concentration of about 200 mM.
34. The method of claim 32 wherein the fluorescent label is selected from the group consisting of fluorescein, fluorescein derivatives, and fluorescein-cyanine conjugates, and the concentration of cations is about 50-200 mM.
35. The method of claim 32 wherein the solution further comprises a buffer selected from the group consisting of Tris, Tricine, 2-amino-2-methyl-1-propanol, and of 2-amino-2-methyl-1,3-propanediol.
36. The method of claim 25 wherein the hybridization-dependent fluorescent emission is monitored during asymmetric PCR.
37. The method of claim 36 wherein about 45 PCR cycles are performed, and a pair of PCR primers are provided in a 1:4 ratio.
38. The method of claim 36 wherein about 60 PCR cycles are performed, and a pair of PCR primers are provided in a 1:8 ratio.
39. A method of analyzing a sample comprising a target nucleic acid sequence, comprising the steps of
combining the sample and an oligonucleotide probe to create a target-probe mixture, wherein the probe includes a virtual nucleotide having a fluorescent label positioned so that the magnitude of fluorescent emission from the fluorescent label is altered by hybridization of the probe to the target nucleic acid sequence,
illuminating the mixture, and
monitoring the fluorescent emission from the fluorescent label.
40. The method of claim 39 further comprising the steps of:
combining the mixture with a pair of oligonucleotide primers, wherein the oligonucleotide primers are configured for amplifying a selected segment of the target nucleic acid sequence,
adding a polymerase, and
amplifying the selected segment of the target nucleic acid sequence.
41. The method of claim 40 wherein the pair of primers have an annealing temperature, and the probe has a Tm 0 to 10 C. below the annealing temperature.
42. The method of claim 40 wherein the fluorescent label is selected from the group consisting of fluorescein, fluorescein derivatives, and fluorescein-cyanine conjugates, the target nucleic acid sequence comprises a guanine residue in the complementary position to the virtual nucleotide, and the fluorescent emission is quenched upon hybridization of the oligonucleotide probe to the target nucleic acid sequence.
43. The method of claim 39 further comprising the step of amplifying a selected segment of the target nucleic acid sequence by a procedure selected from the group consisting of SDA, NASBA, CRCA, Q beta replicase mediated amplification, ICAN, and TMA.
44. The method of claim 39 wherein the fluorescent label is selected from the group consisting of fluorescein, fluorescein derivatives, cyanine derivatives, and fluorescein-cyanine conjugates, and hybridization of the probe to the target nucleic acid places the fluorescent label in a complementary position to a residue other than guanine and results in increased fluorescent emission.
45. The method of claim 44 wherein the residue other than guanine is adenine.
46. The method of claim 39 wherein the fluorescent emission is monitored as a function of temperature.
47. A method for determining the presence of a target nucleic acid sequence in a biological sample comprising:
combining the biological sample with a fluorescent detecting entity consisting essentially of a single-labeled oligonucleotide probe,
wherein the single-labeled probe comprises an oligonucleotide having a sequence complementary to a locus of the target nucleic acid sequence, and having a fluorescent label exhibiting a hybridization-dependent emission attached thereto, wherein hybridization of the probe to a selected segment of the target nucleic acid sequence results in an increase in fluorescent emission of the fluorescent label,
illuminating the biological sample, and
monitoring the hybridization-dependent fluorescent emission.
48. The method of claim 47 further comprising the steps of:
combining the biological sample and the probe with a pair of oligonucleotide primers, wherein the oligonucleotide primers are configured for amplifying the selected segment of the nucleic acid sequence; and
adding a polymerase and amplifying the selected segment of the nucleic acid sequence through a plurality of amplification cycles.
49. The method of claim 48 further comprising the step of determining a maximum dFdT as the probe dissociates from the target nucleic acid sequence.
50. The method of claim 47 wherein the fluorescent label is linked to a base of the oligonucleotide probe and the base is selected from the group consisting of, 4-nitroindole, 5-nitroindole, 6-nitroindole, and 3-nitropyrrole deoxynucleosides.
51. The method of claim 47 wherein the fluorescent label is linked to a base of the oligonucleotide probe and the base is selected from the group consisting of inosine, 5-iodo-cytidine, and nubluarine deoxynucleosides, wherein a residue other than guanine is located on the target nucleic acid sequence at position 1 relative to the position of the label.
52. The method of claim 47 wherein the fluorescent label is attached to a guanine residue and the monitoring step includes monitoring the increased fluorescent emission from the fluorescent label upon hybridization of the probe to the target nucleic acid.
53. The method of claim 47 wherein the fluorescent label is selected from the group consisting of cyanine dyes and LCRed 705.
54. The method of claim 47 wherein the fluorescent detecting entity is immobilized on a surface and the combining step includes placing the sample in contact with the surface.
55. The method of claim 47 further comprising
providing a second fluorescent detecting entity consisting essentially of a second single-labeled oligonucleotide probe, wherein the second single-labeled oligonucleotide probe comprises a second oligonucleotide sequence generally complementary to a second selected segment of the target nucleic acid sequence and having a second fluorescent label linked to an end of the second oligonucleotide sequence, the second fluorescent label exhibiting a hybridization-dependent fluorescent emission at a wavelength different from the fluorescent emission of the first probe, wherein hybridization of the second oligonucleotide probe to the second selected segment results in altered fluorescent emission from the second label and the altered fluorescent signal is independent of fluorescent emission of the first fluorescent detecting entity, and
monitoring the hybridization-dependent fluorescent emission of the second probe.
56. The method of claim 47 wherein the fluorescent label is attached to the 5 terminal nucleotide of the oligonucleotide, and further comprising the steps of
combining the biological sample and the probe with a second oligonucleotide and a polymerase, and
amplifying the target nucleic acid sequence,
wherein the probe and the second oligonucleotide function as a pair of primers for amplification.
57. The method of claim 56 wherein the 5 terminal nucleotide is an A or T residue.
58. A kit for analyzing a biological sample comprising a nucleic acid sequence, comprising:
a. a fluorescent detecting entity consisting essentially of a single-labeled oligonucleotide probe having an oligonucleotide linked to a fluorescent label, wherein said probe is configured to hybridize to a single-stranded locus of the segment so that the magnitude of fluorescent emission from the fluorescent label is increased by hybridization of the probe to the locus; and
b. components for amplification of the nucleic acid sequence.
59. The kit of claim 58 wherein the components include a pair of oligonucleotide primers configured for amplifying a segment of said nucleic acid sequence and a thermostable DNA polymerase.
60. The kit of claim 59 further comprising
a second pair of primers configured for amplifying a second segment of said nucleic acid sequence comprising a second single-stranded locus; and
a second fluorescent detecting entity consisting essentially of a second single-labeled oligonucleotide probe having a second oligonucleotide linked to a second fluorescent label, wherein said second probe is configured to hybridize to the second locus so that the magnitude of the fluorescent emission from the second fluorescent label is increased or decreased by hybridization of the second probe to the target nucleic acid sequence.