1-162. (canceled)
163. A method of differentiating a mammalian trophoblast stem cell, the method comprising modulating miR-124 to induce differentiation of the mammalian trophoblast stem cell to a differentiated cell.
164. The method of claim 163, wherein the mammalian trophoblast stem cell is a human trophoblast stem cell (hTS cell).
165. The method of claim 163, wherein the differentiated cell is a pancreatic progenitor cell.
166. The method of claim 163, wherein the modulating activates miR-124.
167. The method of claim 163, wherein the modulating comprises contacting the mammalian trophoblast stem cell with a fibroblast growth factor (FGF).
168. The method of claim 167, wherein the FGF is bFGF (basic fibroblast growth factor).
169. The method of claim 168, wherein the concentration of bFGF is no more than about 100 ngmL.
170. The method of claim 169, wherein the concentration of bFGF is from about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90, or 90-100 ngmL.
171. The method of claim 170, wherein the concentration of bFGF is about 10 ngmL.
172. The method of claim 167, wherein the modulating further comprises contacting the mammalian trophoblast stem cell with 2-mercaptoethanol.
173. The method of claim 172, wherein the concentration of 2-mercaptoethanol is from about 0.1 to about 10 mmolL.
174. The method of claim 167, wherein the modulating further comprises contacting the mammalian trophoblast stem cell with nicotinamide.
175. The method of claim 174, wherein the concentration of nicotinamide is from about 1 to about 100 mmolL.
176. The method of claim 163, wherein the modulating comprises contacting the mammalian trophoblast stem cell with one or more agents that modulate activity or expression level of CAMP Responsive Element Binding protein 1 (CREB1), mixl1, Cdx2, Oct4, Sox17, Foxa2, or GSK3\u03b2.
177. The method of claim 163, wherein the miR-124 is miR-124a.
178. The method of claim 177, wherein the miR-124a is homo sapiens miR-124a (hsa-miR-124a).
179. The method of claim 178, wherein the hsa-miR-124a is hsa-miR-124-5p (SEQ ID NO:1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof; or hsa-miR-124-3p (SEQ ID NO:2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof.
180. An isolated differentiated cell produced by the method of claim 163.
181. An isolated progenitor cell that expresses betatrophin, betatrophin mRNA, C-peptide, insulin, or any combination thereof, wherein the isolated progenitor cell is differentiated from a mammalian trophoblast stem cell.
182. An isolated progenitor cell that expresses one or more transcription factors comprising Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1, or any combination thereof.
183. A method of screening a substance for use in the treatment of a disease, the method comprising:
a) contacting an isolated progenitor cell of claim 182 with the substance; and
b) detecting a change in the level of at least one transcript or protein in the isolated progenitor cell.
184. A method of screening a substance for cellular modulation or cellular toxicity of a cell, the method comprising:
a) contacting an isolated progenitor cell of claim 182 with the substance;
b) determining a phenotypic or metabolic change in the isolated progenitor cell that results from contact with the substance; and
c) correlating the change with cellular modulation.
185. A method of treating a disease in a mammal in need thereof, the method comprising administering an isolated progenitor cell of claim 182 to the mammal in need thereof.
186. A method of producing insulin, betatrophin protein, or betatrophin mRNA, the method comprising contacting a mammalian trophoblast stem cell with one or more agents to activate miR-124, thereby producing a progenitor cell that secretes insulin in response to glucose stimulation or producing a progenitor cell that produces betatrophin protein or betatrophin mRNA.
The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.
We claim:
1. A method for detecting compounds useful for the prophylaxis andor treatment of Hepatitis C virus infections comprising:
a) contacting a test compound with the human cellular protein gastrointestinal glutathione peroxidase; and
b) detecting said human cellular protein gastrointestinal glutathione peroxidase activity.
2. A method for detecting Hepatitis C virus infections in an individual comprising:
a) providing a sample from said individual; and
b) detecting activity in said sample of human cellular protein gastrointestinal glutathione peroxidase.
3. A method for detecting Hepatitis C virus infections in cells, cell cultures, or cell lysates comprising:
a) providing said cells, cell cultures, or cell lysates; and
b) detecting activity in said cells, cell cultures, or cell lysates of human cellular protein gastrointestinal glutathione peroxidase.
4. A method for preventing andor treating Hepatitis C virus infection andor diseases associated with HCV infection in an individual comprising the step of administering a pharmaceutically effective amount of an agent which inhibits at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or which inhibits at least partially the production of said human cellular protein gastrointestinal glutathione peroxidase.
5. A method for preventing andor treating Hepatitis C virus infection in cells, cell cultures, or cell lysates, comprising the step of administering a pharmaceutically effective amount of an agent which inhibits at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or which inhibits at least partially the production of said human cellular protein gastrointestinal glutathione peroxidase.
6. A method for regulating the production of Hepatitis C virus in an individual comprising the step of administering to an individual a pharmaceutically effective amount of an agent wherein said agent inhibits at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or wherein said agent at least partially inhibits the production of said human cellular protein gastrointestinal glutathione peroxidase.
7. A method for regulating the production of Hepatitis C virus in cells, cell culture, or cell lysates comprising the step of administering a pharmaceutically effective amount of an agent wherein said agent inhibits at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or wherein said agent at least partially inhibits the production of said human cellular protein gastrointestinal glutathione peroxidase in the cells or cell culture.
8. A method according to any one of claims 4-7, wherein the agent is a monoclonal or polyclonal antibody which binds to said human cellular protein gastrointestinal glutathione peroxidase.
9. A method according to any one of claims 4-7, wherein said agent comprises oligonucleotides that bind to the DNA or RNA encoding the human cellular protein gastrointestinal glutathione peroxidase.
10. A method for regulating the expression of the human cellular protein gastrointestinal glutathione peroxidase in an individual comprising the step of administering to the individual a pharmaceutically effective amount of an agent wherein said agent inhibits at least partially the transcription of DNA andor the translation of RNA encoding said human cellular protein gastrointestinal glutathione peroxidase.
11. A method for regulating the expression of the human cellular protein gastrointestinal glutathione peroxidase in cells or cell culture comprising the step of administering to the cells or cell culture a pharmaceutically effective amount of an agent wherein said agent inhibits at least partially the transcription of DNA andor the translation of RNA encoding said human cellular protein gastrointestinal glutathione peroxidase.
12. A method according to any one of claims 10 or 11, wherein said agent is an oligonucleotide which binds to the DNA andor RNA encoding the human cellular protein gastrointestinal glutathione peroxidase.
13. A method for preventing andor treating Hepatitis C virus infection andor diseases associated with HCV infection in an individual comprising the step of administering a pharmaceutically effective amount of an agent which activates at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or which activates or stimulates at least partially the production of said human cellular protein gastrointestinal glutathione peroxidase.
14. A method for preventing andor treating Hepatitis C virus infection in cells, cell cultures, or cell lysates comprising the step of administering a pharmaceutically effective amount of an agent which activates at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or which activates or stimulates at least partially the production of said human cellular protein gastrointestinal glutathione peroxidase.
15. A method for regulating the production of Hepatitis C virus in an individual comprising the step of administering to an individual a pharmaceutically effective amount of an agent wherein said agent activates at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or wherein said agent at least partially activates or stimulates the production of said human cellular protein gastrointestinal glutathione peroxidase.
16. A method for regulating the production of Hepatitis C virus in cells, cell culture, or cell lysates comprising the step of administering a pharmaceutically effective amount of an agent wherein said agent activates at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or wherein said agent at least partially activates or stimulates the production of said human cellular protein gastrointestinal glutathione peroxidase in the cells or cell culture.
17. A method for regulating the expression of the human cellular protein gastrointestinal glutathione peroxidase in an individual comprising the step of administering to the individual a pharmaceutically effective amount of an agent wherein said agent activates at least partially the transcription of DNA andor the translation of RNA encoding said human cellular protein gastrointestinal glutathione peroxidase.
18. A method for regulating the expression of the human cellular protein gastrointestinal glutathione peroxidase in cells or cell culture comprising the step of administering to the cells or cell culture a pharmaceutically effective amount of an agent wherein said agent activates at least partially the transcription of DNA andor the translation of RNA encoding said human cellular protein gastrointestinal glutathione peroxidase.
19. The method according to claims 13-18, wherein said agent is selected from the group consisting of selenium, selenium salts, Vitamin D3 paraquat, retinoids, such as 9-cis retinoic acid, C1-C10 alkyl esters of 9-cis retinoic acid, C1-C10 alkyl amides of 9-cis retinoic acid, N-(4-hydroxyphenyl) retinamide (4-HPR), all-trans-retinoic acid, and retinoic acid analogs such as 6-3-(1-adamantyl)-4-hydroxyphenyl-2-naphthalene carboxylic acid (CD437; AHPN), 4-E-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenylbenzoic acid, and 4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)carboxamidobenzoic acid.
20. A method for selective killing of HCV infected cells in an individual comprising the step of administering to the individual a pharmaceutically effective amount of a radical initiator which is capable of generating artificial oxidative stress conditions within the cells.
21. A method for selective killing of HCV infected cells comprising the step of administering to the cells a pharmaceutically effective amount of a radical initiator which is capable of generating artificial oxidative stress conditions.
22. The method according to claims 20 or 21, wherein the radical initiator is selected from the group consisting of paraquat, 2,2-bipyridyl, 4,4-bipyridyl derivatives, bis-6-(2,2-bipyridyl)-pyrimidines, tris-(2,2-bipyridyl)-ruthenium, dibenzoylperoxide, diacetylperoxide, hydrogen peroxide, di-tert.-butylperoxide, and diazaisobutyronitril.
23. A method for preventing andor treating HCV infections in an individual by at least partially compensating the down-regulation of GI-GPx comprising the step of administering to the individual a pharmaceutically effective amount of at least one antioxidant which is capable of supporting the function of GI-GPx present within the cells.
24. A method for preventing andor treating HCV infections in cells by at least partially compensating the down-regulation of GI-GPx comprising the step of administering to the cells or cell culture a pharmaceutically effective amount of at least one antioxidant which is capable of supporting the function of GI-GPx present within the cells.
25. The method according to claims 23 or 24; wherein the antioxidant is selected from the group consisting of vitamin E (DL–tocopherol), vitamin C (L-ascorbic acid), co-enzyme Q10, zinc, selenium, N-acetyl-L-cycteine, N-acetyl-S-farnesyl-L-cysteine, Bilirubin, caffeic acid, CAPE, catechin, ceruloplasmin, Coelenterazine, copper diisopropylsalicylate, deferoxamine mesylate, R-()-deprenyl, DMNQ, DTPA dianhydride, Ebselen, ellagic acid, ()-epigallocatechin, L-ergothioneine, EUK-8, Ferritin, glutathione, glutathione monoethylester, -lipoic acid, Luteolin, Manoalide, MCI-186, MnTBAP, MnTMPyP, morin hydrate, NCO-700, NDGA, p-Nitroblue, propyl gallate, Resveratrol, rutin, silymarin, L-stepholidine, taxifolin, tetrandrine, tocopherol acetate, tocotrienol, Trolox, U-74389G, U-83836E, uric acid, carboxylic acids, citric acid, phenolic compounds, BHA (butylated hydroxyanisole), BHT (butylated hydroxytoluene), propyl gallate, TBHQ (tert-butyl hydroquinone), tocopherols, lecithin, gums, resin guiac, THBP (trihydroxybutyrophenone), thiodipropionic acid, dilauryl thiodipropionate, and glycines.
26. A method for regulating the activity of the human cellular protein gastrointestinal glutathione peroxidase in an individual comprising the step of administering to the individual a pharmaceutically effective amount of an agent wherein said agent interacts with said human cellular protein gastrointestinal glutathione peroxidase.
27. A method for regulating the activity of the human cellular protein gastrointestinal glutathione peroxidase in cells or cell culture comprising the step of administering to the cells or cell culture a pharmaceutically effective amount of an agent wherein said agent interacts with said human cellular protein gastrointestinal glutathione peroxidase.
28. The method according to claim 26 or 27, wherein the agent is selected from the group comprising small chemical molecules which are organic compounds having a molecular weight below 500 gmol, interferons, aptamers, antioxidants, and radical initiators.
29. A composition useful for the prophylaxis andor treatment of an individual afflicted with Hepatitis C virus andor diseases associated with HCV infection, said composition comprising at least one agent capable of inhibiting activity of said human cellular protein gastrointestinal glutathione peroxidase or capable of decreasing the expression of said human cellular protein gastrointestinal glutathione peroxidase.
30. A composition useful for the prophylaxis andor treatment of an individual afflicted with Hepatitis C virus andor diseases associated with HCV infection, said composition comprising at least one agent capable of increasing the activity of said human cellular protein gastrointestinal glutathione peroxidase or capable of activating or stimulating the expression of said human cellular protein gastrointestinal glutathione peroxidase.
31. The composition according to claim 29 or 30, further comprising pharmaceutically acceptable carriers, excipients, andor diluents.