Author: claimsbot

1-162. (canceled)
163. A method of differentiating a mammalian trophoblast stem cell, the method comprising modulating miR-124 to induce differentiation of the mammalian trophoblast stem cell to a differentiated cell.
164. The method of claim 163, wherein the mammalian trophoblast stem cell is a human trophoblast stem cell (hTS cell).
165. The method of claim 163, wherein the differentiated cell is a pancreatic progenitor cell.
166. The method of claim 163, wherein the modulating activates miR-124.
167. The method of claim 163, wherein the modulating comprises contacting the mammalian trophoblast stem cell with a fibroblast growth factor (FGF).
168. The method of claim 167, wherein the FGF is bFGF (basic fibroblast growth factor).
169. The method of claim 168, wherein the concentration of bFGF is no more than about 100 ngmL.
170. The method of claim 169, wherein the concentration of bFGF is from about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90, or 90-100 ngmL.
171. The method of claim 170, wherein the concentration of bFGF is about 10 ngmL.
172. The method of claim 167, wherein the modulating further comprises contacting the mammalian trophoblast stem cell with 2-mercaptoethanol.
173. The method of claim 172, wherein the concentration of 2-mercaptoethanol is from about 0.1 to about 10 mmolL.
174. The method of claim 167, wherein the modulating further comprises contacting the mammalian trophoblast stem cell with nicotinamide.
175. The method of claim 174, wherein the concentration of nicotinamide is from about 1 to about 100 mmolL.
176. The method of claim 163, wherein the modulating comprises contacting the mammalian trophoblast stem cell with one or more agents that modulate activity or expression level of CAMP Responsive Element Binding protein 1 (CREB1), mixl1, Cdx2, Oct4, Sox17, Foxa2, or GSK3\u03b2.
177. The method of claim 163, wherein the miR-124 is miR-124a.
178. The method of claim 177, wherein the miR-124a is homo sapiens miR-124a (hsa-miR-124a).
179. The method of claim 178, wherein the hsa-miR-124a is hsa-miR-124-5p (SEQ ID NO:1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof; or hsa-miR-124-3p (SEQ ID NO:2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof.
180. An isolated differentiated cell produced by the method of claim 163.
181. An isolated progenitor cell that expresses betatrophin, betatrophin mRNA, C-peptide, insulin, or any combination thereof, wherein the isolated progenitor cell is differentiated from a mammalian trophoblast stem cell.
182. An isolated progenitor cell that expresses one or more transcription factors comprising Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1, or any combination thereof.
183. A method of screening a substance for use in the treatment of a disease, the method comprising:
a) contacting an isolated progenitor cell of claim 182 with the substance; and
b) detecting a change in the level of at least one transcript or protein in the isolated progenitor cell.
184. A method of screening a substance for cellular modulation or cellular toxicity of a cell, the method comprising:
a) contacting an isolated progenitor cell of claim 182 with the substance;
b) determining a phenotypic or metabolic change in the isolated progenitor cell that results from contact with the substance; and
c) correlating the change with cellular modulation.
185. A method of treating a disease in a mammal in need thereof, the method comprising administering an isolated progenitor cell of claim 182 to the mammal in need thereof.
186. A method of producing insulin, betatrophin protein, or betatrophin mRNA, the method comprising contacting a mammalian trophoblast stem cell with one or more agents to activate miR-124, thereby producing a progenitor cell that secretes insulin in response to glucose stimulation or producing a progenitor cell that produces betatrophin protein or betatrophin mRNA.

The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.

We claim:

1. A method for detecting compounds useful for the prophylaxis andor treatment of Hepatitis C virus infections comprising:
a) contacting a test compound with the human cellular protein gastrointestinal glutathione peroxidase; and
b) detecting said human cellular protein gastrointestinal glutathione peroxidase activity.
2. A method for detecting Hepatitis C virus infections in an individual comprising:
a) providing a sample from said individual; and
b) detecting activity in said sample of human cellular protein gastrointestinal glutathione peroxidase.
3. A method for detecting Hepatitis C virus infections in cells, cell cultures, or cell lysates comprising:
a) providing said cells, cell cultures, or cell lysates; and
b) detecting activity in said cells, cell cultures, or cell lysates of human cellular protein gastrointestinal glutathione peroxidase.
4. A method for preventing andor treating Hepatitis C virus infection andor diseases associated with HCV infection in an individual comprising the step of administering a pharmaceutically effective amount of an agent which inhibits at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or which inhibits at least partially the production of said human cellular protein gastrointestinal glutathione peroxidase.
5. A method for preventing andor treating Hepatitis C virus infection in cells, cell cultures, or cell lysates, comprising the step of administering a pharmaceutically effective amount of an agent which inhibits at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or which inhibits at least partially the production of said human cellular protein gastrointestinal glutathione peroxidase.
6. A method for regulating the production of Hepatitis C virus in an individual comprising the step of administering to an individual a pharmaceutically effective amount of an agent wherein said agent inhibits at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or wherein said agent at least partially inhibits the production of said human cellular protein gastrointestinal glutathione peroxidase.
7. A method for regulating the production of Hepatitis C virus in cells, cell culture, or cell lysates comprising the step of administering a pharmaceutically effective amount of an agent wherein said agent inhibits at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or wherein said agent at least partially inhibits the production of said human cellular protein gastrointestinal glutathione peroxidase in the cells or cell culture.
8. A method according to any one of claims 4-7, wherein the agent is a monoclonal or polyclonal antibody which binds to said human cellular protein gastrointestinal glutathione peroxidase.
9. A method according to any one of claims 4-7, wherein said agent comprises oligonucleotides that bind to the DNA or RNA encoding the human cellular protein gastrointestinal glutathione peroxidase.
10. A method for regulating the expression of the human cellular protein gastrointestinal glutathione peroxidase in an individual comprising the step of administering to the individual a pharmaceutically effective amount of an agent wherein said agent inhibits at least partially the transcription of DNA andor the translation of RNA encoding said human cellular protein gastrointestinal glutathione peroxidase.
11. A method for regulating the expression of the human cellular protein gastrointestinal glutathione peroxidase in cells or cell culture comprising the step of administering to the cells or cell culture a pharmaceutically effective amount of an agent wherein said agent inhibits at least partially the transcription of DNA andor the translation of RNA encoding said human cellular protein gastrointestinal glutathione peroxidase.
12. A method according to any one of claims 10 or 11, wherein said agent is an oligonucleotide which binds to the DNA andor RNA encoding the human cellular protein gastrointestinal glutathione peroxidase.
13. A method for preventing andor treating Hepatitis C virus infection andor diseases associated with HCV infection in an individual comprising the step of administering a pharmaceutically effective amount of an agent which activates at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or which activates or stimulates at least partially the production of said human cellular protein gastrointestinal glutathione peroxidase.
14. A method for preventing andor treating Hepatitis C virus infection in cells, cell cultures, or cell lysates comprising the step of administering a pharmaceutically effective amount of an agent which activates at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or which activates or stimulates at least partially the production of said human cellular protein gastrointestinal glutathione peroxidase.
15. A method for regulating the production of Hepatitis C virus in an individual comprising the step of administering to an individual a pharmaceutically effective amount of an agent wherein said agent activates at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or wherein said agent at least partially activates or stimulates the production of said human cellular protein gastrointestinal glutathione peroxidase.
16. A method for regulating the production of Hepatitis C virus in cells, cell culture, or cell lysates comprising the step of administering a pharmaceutically effective amount of an agent wherein said agent activates at least partially the activity of said human cellular protein gastrointestinal glutathione peroxidase or wherein said agent at least partially activates or stimulates the production of said human cellular protein gastrointestinal glutathione peroxidase in the cells or cell culture.
17. A method for regulating the expression of the human cellular protein gastrointestinal glutathione peroxidase in an individual comprising the step of administering to the individual a pharmaceutically effective amount of an agent wherein said agent activates at least partially the transcription of DNA andor the translation of RNA encoding said human cellular protein gastrointestinal glutathione peroxidase.
18. A method for regulating the expression of the human cellular protein gastrointestinal glutathione peroxidase in cells or cell culture comprising the step of administering to the cells or cell culture a pharmaceutically effective amount of an agent wherein said agent activates at least partially the transcription of DNA andor the translation of RNA encoding said human cellular protein gastrointestinal glutathione peroxidase.
19. The method according to claims 13-18, wherein said agent is selected from the group consisting of selenium, selenium salts, Vitamin D3 paraquat, retinoids, such as 9-cis retinoic acid, C1-C10 alkyl esters of 9-cis retinoic acid, C1-C10 alkyl amides of 9-cis retinoic acid, N-(4-hydroxyphenyl) retinamide (4-HPR), all-trans-retinoic acid, and retinoic acid analogs such as 6-3-(1-adamantyl)-4-hydroxyphenyl-2-naphthalene carboxylic acid (CD437; AHPN), 4-E-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenylbenzoic acid, and 4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)carboxamidobenzoic acid.
20. A method for selective killing of HCV infected cells in an individual comprising the step of administering to the individual a pharmaceutically effective amount of a radical initiator which is capable of generating artificial oxidative stress conditions within the cells.
21. A method for selective killing of HCV infected cells comprising the step of administering to the cells a pharmaceutically effective amount of a radical initiator which is capable of generating artificial oxidative stress conditions.
22. The method according to claims 20 or 21, wherein the radical initiator is selected from the group consisting of paraquat, 2,2-bipyridyl, 4,4-bipyridyl derivatives, bis-6-(2,2-bipyridyl)-pyrimidines, tris-(2,2-bipyridyl)-ruthenium, dibenzoylperoxide, diacetylperoxide, hydrogen peroxide, di-tert.-butylperoxide, and diazaisobutyronitril.
23. A method for preventing andor treating HCV infections in an individual by at least partially compensating the down-regulation of GI-GPx comprising the step of administering to the individual a pharmaceutically effective amount of at least one antioxidant which is capable of supporting the function of GI-GPx present within the cells.
24. A method for preventing andor treating HCV infections in cells by at least partially compensating the down-regulation of GI-GPx comprising the step of administering to the cells or cell culture a pharmaceutically effective amount of at least one antioxidant which is capable of supporting the function of GI-GPx present within the cells.
25. The method according to claims 23 or 24; wherein the antioxidant is selected from the group consisting of vitamin E (DL–tocopherol), vitamin C (L-ascorbic acid), co-enzyme Q10, zinc, selenium, N-acetyl-L-cycteine, N-acetyl-S-farnesyl-L-cysteine, Bilirubin, caffeic acid, CAPE, catechin, ceruloplasmin, Coelenterazine, copper diisopropylsalicylate, deferoxamine mesylate, R-()-deprenyl, DMNQ, DTPA dianhydride, Ebselen, ellagic acid, ()-epigallocatechin, L-ergothioneine, EUK-8, Ferritin, glutathione, glutathione monoethylester, -lipoic acid, Luteolin, Manoalide, MCI-186, MnTBAP, MnTMPyP, morin hydrate, NCO-700, NDGA, p-Nitroblue, propyl gallate, Resveratrol, rutin, silymarin, L-stepholidine, taxifolin, tetrandrine, tocopherol acetate, tocotrienol, Trolox, U-74389G, U-83836E, uric acid, carboxylic acids, citric acid, phenolic compounds, BHA (butylated hydroxyanisole), BHT (butylated hydroxytoluene), propyl gallate, TBHQ (tert-butyl hydroquinone), tocopherols, lecithin, gums, resin guiac, THBP (trihydroxybutyrophenone), thiodipropionic acid, dilauryl thiodipropionate, and glycines.
26. A method for regulating the activity of the human cellular protein gastrointestinal glutathione peroxidase in an individual comprising the step of administering to the individual a pharmaceutically effective amount of an agent wherein said agent interacts with said human cellular protein gastrointestinal glutathione peroxidase.
27. A method for regulating the activity of the human cellular protein gastrointestinal glutathione peroxidase in cells or cell culture comprising the step of administering to the cells or cell culture a pharmaceutically effective amount of an agent wherein said agent interacts with said human cellular protein gastrointestinal glutathione peroxidase.
28. The method according to claim 26 or 27, wherein the agent is selected from the group comprising small chemical molecules which are organic compounds having a molecular weight below 500 gmol, interferons, aptamers, antioxidants, and radical initiators.
29. A composition useful for the prophylaxis andor treatment of an individual afflicted with Hepatitis C virus andor diseases associated with HCV infection, said composition comprising at least one agent capable of inhibiting activity of said human cellular protein gastrointestinal glutathione peroxidase or capable of decreasing the expression of said human cellular protein gastrointestinal glutathione peroxidase.
30. A composition useful for the prophylaxis andor treatment of an individual afflicted with Hepatitis C virus andor diseases associated with HCV infection, said composition comprising at least one agent capable of increasing the activity of said human cellular protein gastrointestinal glutathione peroxidase or capable of activating or stimulating the expression of said human cellular protein gastrointestinal glutathione peroxidase.
31. The composition according to claim 29 or 30, further comprising pharmaceutically acceptable carriers, excipients, andor diluents.

1. An apparatus comprising:
a driver to generate an output voltage signal at an output node;
an error sensor to sense error in the output voltage signal based on a reference voltage signal and to control the driver based on the sensed error; and
a variable reference signal generator to generate the reference voltage signal and to vary the reference voltage signal as the error sensor controls the driver.
2. The apparatus of claim 1, wherein the variable reference signal generator is to generate the reference voltage signal at a first voltage level and then at a second voltage level lower than the first voltage level.
3. The apparatus of claim 1, wherein the variable reference signal generator is to generate a step voltage signal.
4. The apparatus of claim 1, wherein the variable reference signal generator is to generate a pulse voltage signal.
5. The apparatus of claim 1, comprising:
a voltage generator to generate another output voltage signal at the output node; and
a controller to control transitions between output voltage signals at the output node.
6. The apparatus of claim 5, wherein the variable reference signal generator is to vary the reference voltage signal to help prevent or reduce voltage droop at the output node in transitioning between output voltage signals.
7. An apparatus comprising:
a driver to generate an output voltage signal at an output node;
an error amplifier to control the driver based on the output voltage signal and a reference voltage signal;
a reference signal generator to output a selected one of a plurality of voltage signals as the reference voltage signal; and
a reference signal controller to control the reference signal generator as the error amplifier controls the driver to select a first one of the plurality of voltage signals as the reference voltage signal and to subsequently select a second one of the plurality of voltage signals as the reference voltage signal.
8. The apparatus of claim 7, wherein the reference signal generator comprises a multiplexer to output a selected one of a plurality of voltage signals as the reference voltage signal.
9. The apparatus of claim 7, wherein the reference signal generator comprises a resistive network to generate a plurality of voltage signals.
10. The apparatus of claim 7, wherein the reference signal controller comprises a pulse generator to output a pulsed reference select signal to the reference signal generator.
11. The apparatus of claim 7, wherein the error amplifier is to generate a control signal based on the output voltage signal and the reference voltage signal, and
wherein the driver comprises a transistor to couple a supply voltage node to the output node in response to the control signal.
12. The apparatus of claim 7, comprising:
a voltage generator to generate another output voltage signal at the output node; and
a controller to control transitions between output voltage signals at the output node.
13. The apparatus of claim 12, wherein the reference signal controller is to select a first one of the plurality of voltage signals having a higher voltage level than the second one of the plurality of voltage signals to help maintain a voltage level at the output node above a reset level in transitioning between output voltage signals.
14. The apparatus of claim 12, wherein the controller is to generate a control signal to activate the voltage generator, and
wherein the voltage generator comprises a transistor to couple a supply voltage node to the output node in response to the control signal.
15. A method comprising:
generating a reference voltage signal;
sensing error in an output voltage signal at an output node based on the reference voltage signal;
controlling the output voltage signal based on the sensed error; and
varying the reference voltage signal as the output voltage signal is controlled.
16. The method of claim 15, wherein the generating comprises generating a reference voltage signal at a first voltage level, and
wherein the varying comprises varying the reference voltage signal to a second voltage level lower than the first voltage level.
17. The method of claim 15, wherein the generating comprises selecting a first one of a plurality of voltage signals as the reference voltage signal, and
wherein the varying comprises selecting a second one of the plurality of voltage signals as the reference voltage signal.
18. The method of claim 15, comprising:
activating a voltage generator to perform the generating, sensing, controlling, and varying; and
deactivating another voltage generator from generating another output voltage signal at the output node.
19. A system comprising:
a battery; and
an integrated circuit having a voltage regulator coupled to receive an input supply voltage signal from the battery to generate a regulated output supply voltage signal at an output node, the voltage regulator including a driver to generate the output supply voltage signal, an error sensor to sense error in the output supply voltage signal based on a reference voltage signal and to control the driver based on the sensed error, and a variable reference signal generator to generate the reference voltage signal and to vary the reference voltage signal as the error sensor controls the driver.
20. The system of claim 19, wherein the voltage regulator includes a voltage generator to generate another output voltage signal at the output node and a controller to control transitions between output voltage signals at the output node.
21. The system of claim 20, wherein the variable reference signal generator is to vary the reference voltage signal to help prevent or reduce voltage droop at the output node in transitioning between output voltage signals.
22. The system of claim 20, wherein the integrated circuit forms at least a portion of a chipset.

The claims below are in addition to those above.
All refrences to claim(s) which appear below refer to the numbering after this setence.

What is claimed is:

1. A gate stack structure for use in a nonvolatile memory device, comprising:
a semiconductor substrate;
a gate stack formed on the semiconductor substrate, the gate stack having a sidewall and a top surface; and
a multi-layer sidewall spacer structure formed on the sidewall of the gate stack;
wherein the multi-layer sidewall spacer structure including a first oxide layer, a first nitride layer, a second oxide layer, and a second nitride layer which are sequentially stacked.
2. The gate stack structure of claim 1, wherein the second oxide layer comprises an etched-back sidewall spacer.
3. The gate structure of claim 1, wherein the second oxide layer comprises a conformal sidewall spacer that overlies the top surface of the gate stack.
4. The gate structure of claim 1, wherein the gate stack comprises:
a first insulating layer, a floating gate, a second insulating layer and a control gate to form a nonvolatile memory cell.
5. The gate structure of claim 1, wherein the gate stack comprises a silicon-oxidenitride-oxide-semiconductor (SONOS) structure.
6. A nonvolatile memory cell, comprising:
a semiconductor substrate having a field region and an active region;
a gate stack formed on the active region, the gate stack having a sidewall and a top surface, the gate stack comprising a first insulating layer, a floating gate, a second insulating layer and a control gate;
a pair of source and drain regions formed on opposite sides of the gate stack within the active region;
a first oxide layer formed on the gate stack, the first oxide layer covering the sidewall of the gate stack;
a first nitride layer formed on the first oxide layer, the first nitride layer covering the sidewall of the gate stack;
a second oxide layer formed on the first nitride layer, the second oxide layer covering the sidewall of the gate stack; and
a second nitride layer formed on the second oxide layer, the second nitride layer covering the sidewall of the gate stack.
7. The nonvolatile memory cell of claim 6, wherein said first oxide layer has a thickness of approximately 5-30 nm.
8. The nonvolatile memory cell of claim 6, wherein said first nitride layer has a thickness of approximately 5-30 nm.
9. The nonvolatile memory cell of claim 6, wherein said second oxide layer has a thickness of greater than approximately 30 nm.
10. The nonvolatile memory cell of claim 6, wherein said second nitride layer has a thickness of greater than approximately 10 nm.
11. The nonvolatile memory cell of claim 6, wherein said second oxide layer comprises an etched-back sidewall spacer.
12. The nonvolatile memory cell of claim 6, wherein the first oxide layer is formed on a portion of the source and drain regions, and wherein the first and second nitride layers are formed sequentially on the first oxide layer on the source and drain regions.
13. The nonvolatile memory cell of claim 12, further comprising an interlevel dielectric layer overlying the gate stack, the interlevel dielectric layer having a borderless contact therein electrically connected to the drain region, wherein the first and second nitride layers are formed sequentially overlying a portion of the field region.
14. The nonvolatile memory cell of claim 6, wherein said second oxide layer conformally covers the top surface of the gate stack.
15. The nonvolatile memory cell of claim 6, wherein the first oxide layer is formed on the source and drain regions, and wherein the first nitride layer, the second oxide layer and the second nitride layer are sequentially formed on the first oxide layer on the source and drain regions.
16. The nonvolatile memory cell of claim 15, further comprising an interlevel dielectric layer formed over the gate stack, and a conductive layer formed in the interlevel dielectric layer electrically connected to the drain region.
17. The nonvolatile memory cell of claim 15, further comprising an interlevel dielectric layer overlying the gate stack, the interlevel dielectric layer having a borderless contact therein electrically connected to the drain region, wherein the first oxide layer, the first nitride layer, the second oxide layer, and second nitride layers are sequentially formed on a region of the field region.
18. A nonvolatile memory device including a cell transistor and a peripheral circuit transistor on a semiconductor substrate, the cell transistor including a first gate stack and the peripheral circuit transistor including a second gate stack, the first and second gate stacks each having a sidewall and a top surface,
the first gate stack further comprising:
a first oxide layer formed on the first gate stack, the first oxide layer covering the sidewall of the first gate stack;
a first nitride layer formed on the first oxide layer, the first nitride layer covering the sidewall of the first gate stack;
a second oxide layer formed on the first nitride layer, the second oxide layer conformally overlying the top surface of the first gate stack and covering the sidewall of the first gate stack; and
a second nitride layer formed on the second oxide layer, the second nitride layer covering the sidewall of the first gate stack,

the second gate stack further comprising:
a first oxide layer formed on the second gate stack;
a first nitride layer formed on the first oxide layer, the first nitride layer covering the sidewall of the second gate stack;
an etched-back oxide sidewall spacer formed on the first nitride layer, the etch-back oxide sidewall spacer covering the sidewall of the second gate stack; and
a second nitride layer formed on the resulting structure including the etched-back oxide spacer, the second nitride layer covering the sidewall of the second gate stack.
19. The nonvolatile memory device of claim 18,
wherein the first gate stack comprises:
a gate dielectric lay layer, a floating gate on the gate dielectric layer, an intergate dielectric layer on the floating gate, and a control gate on the intergate dielectric layer to form a nonvolatile memory cell, and

wherein the second gate stack comprises:
a gate dielectric layer, a gate electrode on the gate dielectric layer to form a peripheral circuit transistor.
20. A NOR-type nonvolatile memory cell, comprising:
a semiconductor substrate;
a gate stack formed on the semiconductor substrate, the gate stack having a sidewall and a top surface;
a pair of source and drain regions on opposite sides of the gate stack, the drain region having an abrupt junction within the semiconductor substrate;
a first oxide layer formed on the gate stack, the first oxide layer covering the sidewall of the gate stack;
a first nitride layer formed on the first oxide layer, the first nitride layer covering the sidewall of the gate stack;
a second oxide layer formed on the first nitride layer, the second oxide layer covering the sidewall of the gate stack; and
a second nitride layer formed on the second oxide layer, the second nitride layer covering the sidewall of the gate stack.
21. A nonvolatile memory device including a cell transistor and a peripheral circuit transistor formed on a semiconductor substrate, the cell transistor including a first gate stack and the peripheral circuit transistor including a second gate stack, the first and second gate stacks each having a sidewall and a top surface, first sourcedrain regions formed adjacent the first gate stack and second sourcedrain regions formed adjacent the second gate stack, the nonvolatile memory device, comprising:
a first oxide layer formed on the first and second gate stacks, the first oxide layer covering the sidewall of the first and second gate stacks;
a first nitride layer formed on the first oxide layer, the first nitride layer covering the sidewall of the first and second gate stacks,
a conformal oxide spacer layer covering the sidewall and the top surface of the first gate stack;
an etched-back oxide sidewall spacer formed on the first nitride layer, the etched-back oxide sidewall spacer covering the sidewall of the second gate stack; and
a second nitride layer formed on the conformal oxide spacer layer and the etched-back oxide sidewall spacer, the second nitride layer covering the sidewall of the first and second gate stacks,
wherein each of the first sourcedrain regions has a single highly-doped impurity region and each of the second sourcedrain regions has a LDD structure.
22. The nonvolatile memory device of claim 21, wherein the first sourcedrain regions includes a lightly-doped impurity region, shielding the single highly-doped impurity region.